You are studying a new operon that you have discovered in E. Coli that you have named the Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have

Biology (MindTap Course List)
11th Edition
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Chapter14: Gene Regulation
Section: Chapter Questions
Problem 11TYU
icon
Related questions
Question

These are biochemistry questions:

Questions are part A and B.

You are studying a new operon that you have discovered in E. Coli that you have named the Up
Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have
discovered three genes (sleep, wings, and energy) encoded within the polycistronic template
made from the operon. The transcription start site is indicated at the arrow and the protein
encoding sequences are encoded by the boxes with the names of the genes inside, with a blow
up of the nucleotide sequence at the promoter, with the transcription start occurring at the C.
(Asterisks for part F)
sleep
wings
energy
5'-тстTGACАСАТСAGGCTAGCATTATAAAGсCGGCTAGCTAGCATGCAAAGCСТАССТТ-3'
3' -ACAACTGTGTAGTCCGATCGTAATATTTCGGCCGATCGATCGTACGTTTCGGATGCAA-5'
A. Place boxes around the -10 and -35 elements of the core promoter. What binds to these
regions of the promoter and why is it important?
Transcribed Image Text:You are studying a new operon that you have discovered in E. Coli that you have named the Up Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have discovered three genes (sleep, wings, and energy) encoded within the polycistronic template made from the operon. The transcription start site is indicated at the arrow and the protein encoding sequences are encoded by the boxes with the names of the genes inside, with a blow up of the nucleotide sequence at the promoter, with the transcription start occurring at the C. (Asterisks for part F) sleep wings energy 5'-тстTGACАСАТСAGGCTAGCATTATAAAGсCGGCTAGCTAGCATGCAAAGCСТАССТТ-3' 3' -ACAACTGTGTAGTCCGATCGTAATATTTCGGCCGATCGATCGTACGTTTCGGATGCAA-5' A. Place boxes around the -10 and -35 elements of the core promoter. What binds to these regions of the promoter and why is it important?
B. What is the first 6 nucleotides of the mRNA sequence generated at this operon?
Transcribed Image Text:B. What is the first 6 nucleotides of the mRNA sequence generated at this operon?
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 3 steps with 1 images

Blurred answer
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biology (MindTap Course List)
Biology (MindTap Course List)
Biology
ISBN:
9781337392938
Author:
Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:
Cengage Learning