You are studying tumor cells excised from a patient with suspected Colorectal cancer and you will like to evaluate the status of the DNA repair mechanisms in the tissues. Which of these will be helpful in estimating the functional status of the DNA repair mechanisms in this tissue? Group of answer choices Monoubiquitinated FANCD2 protein PhosphorylatedDNA-PK DNA-damage induced foci All of these

You are studying tumor cells excised from a patient with suspected Colorectal cancer and you will like to evaluate the status of the DNA repair mechanisms in the tissues. Which of these will be helpful in estimating the functional status of the DNA repair mechanisms in this tissue? Group of answer choices Monoubiquitinated FANCD2 protein PhosphorylatedDNA-PK DNA-damage induced foci All of these

Name: You are studying tumor cells excised from a patient with suspected Col
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You are studying tumor cells excised from a patient with suspected Colorectal cancer and you will like to evaluate the status of the DNA repair mechanisms in the tissues. Which of these will be helpful in estimating the functional status of the DNA r

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 10P: Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli...

See similar textbooks

Similar questions

Using the straight-chain sugar convention where the vertical lines represent sugars and the diagonals are phosphodiester bonds, choose the correct structure of the DNADNA strand that encoded this short stretch of RNA. pppApCpUpGpGpCpApA−OH
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections. Human; Human EBV; Human EBV; EBV Human; EBV
True or False:If a DNA helix contains bases pairs of XY, for PCR to copy the helix one would need to add XTP in addition to the common reagents
Referring to Figure 7-20, answer the following questions:a. What is the DNA polymerase I enzyme doing?b. What other proteins are required for the DNApolymerase III on the left to continue synthesizingDNA?c. What other proteins are required for the DNApolymerase III on the right to continue synthesizingDNA?
Suppose the gaps between the Okazaki fragments are not sealed and a continuous strand does not form. You could conclude that this is due to a mutation for which enzyme? DNA polymerase DNA helicase DNA ligase RNA primase
If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? 5'-TGACTAACTG-3' 3'-TGACTAACTG-5' 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5'
Which of these two changes is more difficult for DNA repair enzymes to fix correctly? Explain why.
non-coding DNAs can be put into two groups, name them
In each case, if 1 µg of DNA was digested by these enzymes, calculate the number of ng of DNA present in each fragment (complete the table).
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG