You synthesized 3 pre-mRNAs, as shown, performed splicing in a test tube, and monitored the splicing reaction on a gel by autoradiography. What can you conclude from this data? Select all that apply. You may select multiple options. These pre-mRNAs were incubated with a nuclear extract and splicing over time (0-120 min) was followed by gel electrophoresis. m7GpppG 0 30 60 120 m/Gppp 13- Gppp 13- (uncapped) 13- GpppG 0 30 60 120 O Cap affects the splicing of the second intron O None of these options O Cap affects the splicing of the first intron O Cap affects splicing of all introns O Cap has no effect on splicing exon intron 14 14- uncapped 0 30 60 120 min 15 Fig. 15.29 13 14 13 14 15 () 15 13 14 15 (0) 13 14 15 (4)

You synthesized 3 pre-mRNAs, as shown, performed splicing in a test tube, and monitored the splicing reaction on a gel by autoradiography. What can you conclude from this data? Select all that apply. You may select multiple options. These pre-mRNAs were incubated with a nuclear extract and splicing over time (0-120 min) was followed by gel electrophoresis. m7GpppG 0 30 60 120 m/Gppp 13- Gppp 13- (uncapped) 13- GpppG 0 30 60 120 O Cap affects the splicing of the second intron O None of these options O Cap affects the splicing of the first intron O Cap affects splicing of all introns O Cap has no effect on splicing exon intron 14 14- uncapped 0 30 60 120 min 15 Fig. 15.29 13 14 13 14 15 () 15 13 14 15 (0) 13 14 15 (4)

Name: You synthesized 3 pre-mRNAs, as shown, performed splicing in a test t
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You synthesized 3 pre-mRNAs, as shown, performed splicing in a test tube, and monitored the splicing reaction on a gel by autoradiography. What can you conclude fromthis data? Select all that apply. You may select multiple options.These pre-mRNAs we

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?
Researchers are manipulating the gene cxx2 for their experiments, and they have inserted a smallnumber of base pairs randomly somewhere into the gene. They isolate several versions (with differentinsertions) of this modified gene and carry out an RT-PCR using a primer that recognizes thetranscriptional start site area (eg. from +1 to +20), and a primer that binds to the polyA tail.For the second modified gene sample, they observe that the mature mRNA is now several basepairs longer, however splicing has not been affected. They examine the protein and identify thatit has significant changes to its amino acid sequence, altering its length. Which of the letteredarrowheads indicates the location where this insertion could be? (There could be one answer orseveral. Give all answers that apply)
You construct a translational reporter gene fusion of your favourite gene. How can you assess whether the translational fusion is functionally active?
summarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’a. What is the mRNA transcript of the anticoding strand of the DNA model?
Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post-transcriptional processing. Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference. DNA strand: 5'-TCGAAACGAGCTGCAGCTAGCTAGCTACGTCAGCTGCATCTGTCTACGAGCGACTGTCTAGCATAGCGTAGCTGC-3 'Complementary strand: 3'-TCGAAACGAGCTGCAGCTAGCTAGCTACGTCAGCTGCATCTGTCTACGAGCGACTGTCTAGCATAGCGTAGCTGC-5'
The text has discussed the RNA-Seq technique, whichquantifies the amounts of mRNAs present in a given celltype at a given time. We have also described the methodof ribosome profiling, which quantifies the levels ofmRNA sequences that are being translated actively in acell population at a given time. But even when bothkinds of experiments are performed, the data do not tellus accurately the relative amounts of the protein products of these mRNAs in the cells at that time. Why not?What elements of gene expression do these techniquesaccount for and what elements do they ignore?
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′