.  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single…

A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule…

Q: Indicate 2 ways which ensure DNA fidelity when carrying the message to protein which occur in the…

A: DNA fidelity refers to the ability of the DNA polymerase to avoid or rectify the errors made in the…

Q: Provide the complementary strand and the RNA transcription product for the following DNA template…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA…

A: The RNA sequence would be same as coding strand (except thiamine is replaced by uracil) and opposite…

Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…

A: According to the question, we have seen a diagram, where we have to transcribe the two new…

Q: Briefly describe two of the tree functions of RNA polymerase

A: RNA polymerase is a catalytic enzyme that is liable for duplicating a DNA succession into a RNA…

Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is…

Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…

A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…

Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…

A: Introduction :- Gene expression is the process of formation of response or functional part through a…

Q: table opposite shows the standard (coding strand et codes for the 20 amino acids involved in protein…

A: DNA is a nucleic acid.

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: Explain the synthesis of the leading and lagging strands during DNA replication and identify the…

A: The enzyme DNA polymerase with an RNA primer can synthesize new strands in the 5' to 3' direction.…

Q: List at least five properties that DNA polymerases and RNA polymerases have in common. List at least…

A: The polymerase is an enzyme that synthesizes the long chains of nucleic acids or polymers. The DNA…

Q: 9The table opposite shows the triplet codes for the 20 amino acids involved in protein synther A…

A: Codons are three DNA sequence triplets that code for specific amino acids and there are a total of…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: Explain Leading-strand and lagging-strand DNA synthesis.

A: During the process of normal replication 1. As compared to leading strand synthesis, lagging strand…

Q: 5’GCTATAAAGCGTATCGCGTCATA 3

A: Complementary mRNA      5’GCT ATA AAG CGT ATC GCG TCA TA '3     3'CGA UAU UUC GCA UAG CGC AGU AU '5

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat…

A: WT replication without slippage:

Q: . The table opposite shows the standard (coding strand) DNA riplet codes for the 20 amino acids…

A: Introduction The process of synthesis of proteins occurs in two steps which are transcription and…

Q: Transcription is initiated when:   a. initiation factors assemble ribosomal subunits, mRNA, and…

A: Transcription:  It is Initial copying of the DNA strand with RNA Polymerase to make RNA. Before the…

Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATA ATGAAAATCGGGCCC MRNA- AA- DNA -…

A: Coding DNA strand and mRNA has same sequence except T in DNA and U in RNA  mRNA - Complementary to…

Q: Explain the molecular mechanism of DNA polymerization by DNA polymerase and explain why DNA…

A: DNA replication is necessary to ensure genetic continuity and genome inheritance from parents to…

Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…

A: The process of copying the information in a strand of DNA to produce an mRNA is called…

Q: Use the (non-template) DNA strand below to determine which is the promoter/sigma binding region:…

A: Introduction: A promoter is a DNA sequence to which proteins bind to start transcription of a single…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends…

A: An anticodon is a trinucleotide sequence that is complementary to the corresponding codon in a…

Q: Describe the DNA replication process, including its initiation and the events that occur at the…

A: Watson and Crick discovered that DNA was a two-stranded double helix which provided an idea of how…

Q: Identify the sites of lagging strand synthesis. Select all that are true. B

A: DNA replication of the double-stranded DNA occurs simultaneously at both strands. The replication…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write…

A: Nucleic acids are the essential macro molecules that carry and transmit genetic information in the…

Q: In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…

A: A DNA segment is generally a genomic feature recognized by anonymous DNA probes. Symbols for such…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’    Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: Describe in detail how the leading and lagging strands are synthesized concurrently during DNA…

A: A new strand of DNA is always synthesized in the 5' to 3' direction by the DNA polymerase enzyme.…

Q: b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand DNA…

A: The mRNA is produced from the DNA template by the transcription process and then mRNA is used for…

Q: Explain semi-conservative modelmof DNA replication b) discuss initiation in DNA replication and…

A: DNA replication is the process in which the copies of DNA is made by the action of several enzymes…

Q: Match Column A with Column B. pulls a portion of the DNA strands apart from each A. 3rd event other,…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: an adult with a history of tanning has his genome sequenced. The beginning of a protein coding…

A: Mutations are the changes in the genetic sequence that may result in genotypic or phenotypic…

Q: Define and indicate the significance of primer RNA during DNA replication

A: DNA is a polymer of nucleotides.

Q: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3'    Write the sequence of the DNA…

A: The central dogma of life involves three processes. They are: Replication: In this process, copies…

Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…

A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…

Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.

A: Transcription is the process in which RNA is made from DNA, while  translation is the process in…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Translation is process in which proteins are synthesized.

Q: Describe the processes of transcription and translation from DNA to polypeptide chain

A: Polypeptides are amino acid chains joined together by peptide bonds. Amino terminal or N terminal…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.