1. 5.5µg/mL 2. 750mL 3. 29μµL 4. 1.55g 5. 0.045mg 6. 9.5mg/L 7. 850g 8. 3.5 x 10 mL 9. 4.50 x 10³g/mL 10. 9.5mg/L USIN 11. 4.50 x 107mg/mL= 12. 3.5 x 10°g/mL 13. 6.5 x 10 mg/mL = 14. 9.5 x 10ỏng 15. 3.5 x 10 μL ng/mL L mL mg g g/L µg _μL µg/μL µg/μL g/L g/L µg/μL µg CE:
Q: The lens of the eye si the light refracting medium of the eye, and ti has no mitochondria. Glucose…
A: "Since you have posted a question with multiple sub parts, we will provide the…
Q: A drug with an elimination half-life of 1 hour was given to a male patient weighing 60 g by IV at…
A: Given, Rate of administration IV (R) is 300 mg/hr Plasma drug concentration at 7 hours was (C) 11…
Q: Buffers in pharmaceutical and biological systems
A: The pH of a solution refers to the concentration of H+ ions in a solution. If the H+ concentration…
Q: Sulfur compounds give onions their unique flavor and properties. Compound 1 is the starting material…
A: Allinase is an enzyme which catalyzes a biochemical reaction in which S-alkyl-L-cysteine S-oxide…
Q: TRUE OR FALSE 1. Rotational entropy is the freedom to move in three-dimensions. 2. Vitamin B1…
A: In the cellular environment, the condition do not allow biochemical reactions to occur at…
Q: The hydrolysis of ATP has an enthalpy and entropy of -24.3 kJ/mol and +21.6 J.K-1.mol-1,…
A: ATP (Adenosine Triphosphate) is an important molecule in living organisms as it provides energy for…
Q: Consider the equilibrium of arginine below: NH₂ NH₂ H₂N: 0 NH OH H₂NE pKa-2.17 NH3 NH H₂N: pKa 9.04…
A: The proteins are constituted of 20 naturally occurring amino acids. The net charge on an amino acid…
Q: give an example of how signal transduction plays a role in disease
A: Introduction: Our human body undergoes various processes to coordinate individual cells to support…
Q: 9. Briefly describe and draw the structure of the following disaccharides in their ring structure.…
A: A. Sucrose structure: O O| || || |O-C-O-C-H H-C-O-C-O| || || |H H B. Maltose structure: O O| || ||…
Q: How much 6x loading dye should be added to 49 uL of DNA? Report you answer in units of uL, with one…
A: The equation of dilution: M1xV1 = M2xV2 Where, M1 is the molar concentration of the stock solution.…
Q: Explain the role of carnitine in the energy supply of the myocardium
A: Carnitine plays an important in heart's metabolism. It's responsible for transporting fatty acids,…
Q: ATP + H₂0 ➜ ADP + Pi 3Na+ (inside) + 2K+ (outside) AG = -30.5kJ/mol + ATP4 + H₂O → 3Na* (outside) +…
A: Gibbs's free energy, known as free energy or G, is a thermodynamic quantity that represents the…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: Reciprocal regulation of opposing pathways is necessary to avoid the wasteful synthesis and…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: Which of the following polypeptides would be most likely to form an a helix? Explain your answer.…
A: A polypeptide chain folds into a protein in its native, three-dimensional form through a process…
Q: How much 4x loading dye should be added to 11 uL of DNA? Report you answer in units of uL, with one…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ Determine the…
A: Genes are functional segments of DNA that code for particular proteins. Each gene has its unique…
Q: Consider the reaction below. Where would the labelled carbon (represented by the asterisk * in the…
A: As you can see the reactant side is undergoing the reaction where there is removal of CO2 and NADP+…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. b)…
A: Insulin (release from the beta cells of pancreas) and glucagon (release from the alpha cells of…
Q: Draw the potential tautomers of guanine. Based on Question 1c) (i), label the patterns of hydrogen…
A: Guanine is a nucleotide base found in nucleic acids like DNA and RNA . It pairs with Cytosine with…
Q: An aminoacyl-tRNA is initially bound to the ribosome in prokaryote at the A site on the 70S subunit…
A: A small RNA molecule known as transfer RNA (tRNA) is essential for the production of proteins.…
Q: During the metabolism of glucose in anaerobic cells, the enzyme lactate dehydrogenase is essential…
A: Lactate dehydrogenase catalyzes the interconversion of pyruvate and lactate. The enzyme is an…
Q: hat will happen to CRH secretion in a patient given very high doses of a synthetic glucocorticoid…
A: Glucocorticoids (or, more colloquially, glucocorticosteroids) are a type of corticosteroid, which is…
Q: myristic acid (14:0) carbon dioxide and water a. how many moles of ATP produced from 1 round of the…
A: Human cellular membranes contain myristic acid, albeit at much lower concentrations. It is a…
Q: PK 12.5 HO. ОН PK,43 Compound X О
A: The compound X has two distinct stages, corrresponding to deprotonation of two different groups. At…
Q: True or false 1. Heterogenous antibodies used for structural studies can be obtained by monoclonal…
A: Heterogenous antibodies - Heterogenous terms indicates that the molecule is a hybrid. i.e. a single…
Q: Which of the conditions would result in the greatest amount of transcription of the lac operon? I.…
A: Gene expression essentially involves the production of the polypeptide chain that a certain gene has…
Q: Fatty acids released by hormone sensitive lipase in adipocytes are transported to muscle by: OA)…
A: The adipose tissue stores surplus nutrients in the form of neutral lipids in the body that in turn…
Q: Question 7 Which of the following translocases serves as the central entry gate for cytosolic…
A: Mitochondria is a cell organelle whose purpose is to generate ATP via oxidative phosphorylation. It…
Q: I. ATP Calculation A. Given that three molecules of glucose underwent full oxidation, how many of…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Question 16 Proteins imported into the nucleus are transported via which mechanism? tranlocational…
A: The proteins are constituted of twenty naturally occurring amino acids. The proteins have signal…
Q: What is the catalytic triad on chymotrypsin? Detail its importance.
A: Proteases are hydrolytic enzymes that cleave peptide bonds that link two amino acid residues…
Q: Why two strands of DNA are not identical but are complimentary to each other?
A: Introduction DNA acts as genetic material in our body. DNA consists of nitrogenous bases, pentose…
Q: What does an area of clearing indicate in biochemical test?
A: Measuring a nutrient or its metabolite in the blood, faeces, urine, or other tissues that have a…
Q: The B-oxidation of the saturated 14-carbon fatty acid myristic acid yields the following NET amount…
A: In beta oxidation, large fatty acids that have been transformed into acyl-CoA chains are gradually…
Q: c. In lab, you recorded a UV-Vis spectrum of a mixture of proteins. What best explains why two major…
A: (c). Every substance absorbs a certain amount of energy, when a light of particular intensity…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. a)…
A: Our body primarily uses glucose as a source of energy. In order to carry out the normal functions of…
Q: Which of the following is not true? A.) A single activating enzyme can interact with all the tRNAs…
A: The 'activating enzyme' mentioned in option 1 is aminoacyl tRNA synthetase. Aminoacyl tRNA…
Q: Which of the following statements regarding CoQ is false a. It resides in the inner…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron from…
Q: Consider the amino acid aspartic acid for this problem. Aspartic acid can be considered a triprotic…
A: Aspartic acid have 3 ionizable groups in it. They are; alpha- carboxyl group alpha-amino group…
Q: Match the following steps of oxidative phosphorylation in increasing order from beginning (1) to end…
A: Oxidative phosphorylation is the process by which oxidation of NADH and FADH2 by the complexes in…
Q: Question 4 An N-linked glycoprotein contains a glycan covalently linked to which specific amino acid…
A: the proteins are constituted of twenty naturally occurring amino acids that are linked vis peptide…
Q: ）picture1: what bond is this between cytosine and ribose？ 2）picture2 ： what bond is that bewteen…
A: Nucleotides are compounds made up of a nitrogen base, a sugar and a phosphate. The base can be…
Q: TRUE OR FALSE 1. Carboxybiotin is covalently linked to an enzyme via E- amino group of a lysine…
A: An enzyme is a substance that acts as a catalyst in the living systems. It increases the rate of…
Q: 1. What are buffers? 2. Using the pH scale, describe how you can indicate if the blood solution is…
A: Buffers are chemical systems which allows a solution to have a stable pH. Most buffers can help…
Q: ) Describe the 10 enzymatic reactions of glycolysis and the organization of the pathway in 2 main…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: In the initial step of the Q cycle, the electrons of QH2 (or ubiquinol) are transferred to: OA)…
A: The complex III of the electron transport chain ( Q-cytochrome c oxidoreductase) consists of three…
Q: A. Dissolution of drugs Tablets Aspirin Bisacodyl Generalizations: Vinegar Solution pH: 2.5 5…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: The processes that are involved in protein degradation and folding release energy in the form of ATP…
A: Protein degradation is the process in which proteins are hydrolysed and broken down into individual…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- KCI for injection contains 40 mEq in 20 mL. An order requires 15 mEq, how many mL are needed?Calculate the oral loading dose (LD) of digoxin for Miss Jones who weighs 60 kg. The desired plasma concentration (Cp) is 1.5 mcg/L, volume of distribution (Vd) is 7.3 L/kg, the salt factor (S) is 1 and bioavailability fraction (F) is 0.7.Give your answer to the nearest whole number of micrograms.The equation below can be used:Loading Dose = Cp desired x VdS x FRecommend an appropriate dosage of digoxin for this patient given a trough digoxin concentration of 2.7 ng/mL.
- 750mL mL of a dextrose solution is to be infused at 45 mL/h starting at 1600 hours. At what time will this IV be completed?a. Order: Oxacillin 500 mg IV q. 6hSupply: Oxacillin 2 g, multi-dose vialDirections: Reconstitute with 10 mL diluent to yield 250 mg/mL, total volume 120 mLGive: __________ mLb. How many total doses are available for patient use?c. There will be sufficient Oxacillin for how many days?