1. corrected DNA sequences2.mRNA sequence3. Amino acid sequence and description4. Drawing of the ice cream with the label Procedure:You must analyze the genes of its DNA to determine what traits the sundae has and then create a model of your ice cream sundae. These genes must be assembled in order Ⓒ1. Transcribe your DNA sequence into a mRNA sequence (do not forget to break your sequence into codon segments).2. Use a genetic code chart to translate your mRNA codons into amino acids.3. Use the amino acid sequence to determine what trait (phenotype) each gene will express for your ice cream sundae.GenesGene 1 - ice cream typeGenetics determine the traits of an Ice CreamAmino Acid SequenceMET-VAL-SER-LEU-STOPMET-VAL-SER- LYS-STOPGene 2 - ice cream type MET-TYR-PRO-GLU- GLU-LYS-STOPMET-VAL-PRO-THR- GLN- LYS-STOPGene 3 - MET-LEU-LEU-LEU- PRO-STOPMET-LEU-LEU-SER- ALA-STOPGene 4 MET-ALA- VAL- VAL-STOPMET-VAL-ALA-ALA-STOPGene 5 MET-HIS - ILE-STOPMET-HIS-HIS-STOPGene 6- MET-SER- PRO- VAL-STOPMET-VAL- PHE-TYR-STOPGene 7-MET-ASN- ILE-LEU-LEU- PRO- THR-STOPMET-ASN- ILE- PRO- PRO- PRO- THR-STOPGene 8-MET-VAL- ASN- ASN- ALA-STOPMET-ASN- ASN- ASN-ALA-STOPGene 9 MET-PHE- SER- GLY-STOPMET-PHE-PHE-GLY-STOPGene 10-MET-ARG-TYR- CYS- LYS-STOPMET-ARG- ARG- ASN- THR-STOPDescriptionChocolateVanillaFudge SwirlNeopolitanM&M'sChocolate ChipsRedi-WhipMarshmallowsTwixKit KatChocolate SyrupCaramel SyrupOreosJelly BeansSnickers BitesReeses PiecesRound SprinklesShaped (not round) SprinklesCherryStrawberry

Name: 1. corrected DNA sequences2.mRNA sequence3. Amino acid sequence and de
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. corrected DNA sequences2.mRNA sequence3. Amino acid sequence and description4. Drawing of the ice cream with the label Procedure:You must analyze the genes of its DNA to determine what traits the sundae has and then create a model of your ice crea

The gene is the sequence of DNA which carry information to code for a specific protein or functional…

Answered: 1. corrected DNA sequences 2.mRNA…

Science

Biology

1. corrected DNA sequences 2.mRNA sequence 3. Amino acid sequence and description 4. Drawing of the ice cream with the label

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 9QP

See similar textbooks

Similar questions

BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step…
When doing a lab that involves Extraction of Genomic DNA from adult Drosophila melanogaster. - What are the controls you should use and why use these? What is special about the genomic DNA? What do you expect to find (using these genomic DNA samples)? please help!
Transcribe and translate the DNA strand Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
Please answer fast You have been given the DNA sequence for a particular fragment of DNA. You then isolated the mRNA made from that DNA and amplified it by PCR. You then determined the sequence of the cDNA obtained from different cells. You notice a difference. In the sequence obtained from DNA sequencing you see that a codon is 5' CAG however on the cDNA sequence it is TAG. These results are confirmed by repeated DNA sequence analysis using DNA and cDNA from different cell cultures (same species and tissue samples). What can explain this? a.The DNA must have been mutated in all the cells that were used to isolate mRNA since the cDNA should always match the genomic sequence. b.Any cDNA made through RT-PCR will have T's substitued for genomic C's that are methyulated. c.The mRNA must have been deaminated at the cytosine. d.The cDNA generated most likely had a technical mistake caused by poor fidelity of the Taq enzyme.
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
Ali sequenced a plant protein. He is not a bioinformatician and is actually scared of computers. Yet, he would like to know what the structure might look like to do some rounds of rational mutagenesis. I told him I would collect a group of bioinformaticians to solve this problem. Please don't disappoint him. He came up with this sequence: SVCCPSLVARTNYNVCRLPGTEAALCATFTGCIIIPGATCGGDYAN Find the template? Use swiss model to build the structure?
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:
Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG
I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3 prime mRNA sequence. For example; if you are given the mRNA sequence AUU ACA GUG UAU AAA, what would be the corresponding NON-TRANSCRIBED DNA sequence? The mRNA sequence that I listed is 5 prime to 3 prime
Chemistry How does the mRNA Covid Vaccine work?Can it get into your DNA? What other mRNA vaccines have we been working on? Why do we need the vaccine EVEN though people can still get Covid? Be sure to link references.
Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.