Answered: 1. How does genetic drift affect human…

Science

Biology

1. How does genetic drift affect human evolution? Discuss it and present possible evidences.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter19: Population Genetics And Human Evolution

Section: Chapter Questions

Problem 19QP: Measuring Genetic Diversity in Human Populations The theory of natural selection has been summarized...

See similar textbooks

Related questions

Q: Sulfamethoxazole is a type of sulfonamide antibiotic. Its absorbance ranges from 250-300 nm in a UV…

A: Sulfamethoxazole Sulfamethoxazole is a sulfonamide based bacteriostatic antibiotic, widely used to…

Q: In the following experiment, strain B mouse is subjected to sublethal irradiation and a bone marrow…

A: Innate and adaptive immune responses are characteristics of the immune system. The immune system's…

Q: In the following pedigree of an autosomal recessive trait, which individuals in generation III…

A: Autosomal recessive traits: The traits present on chromosomes other than sex chromosomes, the…

Q: a. Which characteristic found in the prey species is most likely to be advantageous for survival?…

A: Prey animals must always be on edge and lookout for their predation. In order, to survive they…

Q: what if a mutation resulted in the enzyme DNA polymerase III being non-functional? How would that…

A: The mutation is defined as the change in sequence of nucleotides in a gene. The mutation can either…

Q: e answer fast

A: Answer 17: -Kd value of antibodies is inversely proportional to their binding affinity. Hence,…

Q: Problem #3 In some plants, green pod color (G) is dominant to yellow pod color (g). If an individual…

A: The genotype of the population is a number of populations with the given genotype and is calculated…

Q: Two gene loci, A and B, are on separate chromosomes and alleles A and B are dominant over alleles a…

A: Dihybrid cross Is a mating experiment involving two creatures that are genetically identical in two…

Q: human evolution

A: genetic drift can result in the loss of rare alleles and decrease the gene pool. Genetic drift can…

Q: How does the study of plate tectonics help in understanding probable evolutionary events? Explain…

A: In this question we have to describe about how tectonic plates sliding result in evolution. See full…

Q: The patient of 40 years complains of intensive pains behind the breastbone, which are stopped by the…

A: Dear student since you asked a question with more than 3 subparts, we can only answer the first…

Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…

A: In this question we have to describe about regulation of genes . See full answer in step 2.

Q: Why was this row of evergreens planted on an Indiana farm?

A: Biofencing Is often referred to as Live Fencing. These are tree or shrub lines placed along farm or…

Q: Which of the following is not an example of constitutively expressed gene? a. genes for cell…

A: Constitutive genes are those genes which are not regulated by other genes. These genes expressed…

Q: a. Briefly discuss (using three sentences) how the concepts and/or techniques in molecular biology…

A: As COVID-19 was discovered in Hubei Province, China, in December 2019, COVID-19 has spread…

Q: b) Phenotypes of progeny from test cross: WT = 12, Circle nonparental (NP) classes above. Genotype…

A: Test cross This cross is done to identify the genotype of the individual. In this cross, the…

Q: In corn, purple kernels (P) are dominant over yellow kernels (p) and round kernels (R) are dominant…

A: The chi-square analysis is used in different experiment to compare the observed and expected data.…

Q: Cross #1: P: Homozygous scarlet-eyed males F₁ Fs Homozygous brown-eyed females X 1072 Wild-type…

A: Answer :- a) Phenotypic ratio of F2 generation is 9 :3: 3: 1, for wild type eye, scarled eye,brown…

Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…

A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…

Q: Explain why many molecules that demonstrate significant absorption in the UV/Vis do not also…

A: UV/ Vis Ultraviolet–visible or UV/Vis refers to the absorption of the electromagnetic radiation in…

Q: ch of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain the…

A: Enhancer is a cis-acting ( on the same gene it controls) DNA regulatory sequence which strongly…

Q: What kind of systems have been developed to detect CSCs? Describe by giving examples. Please explain…

A: Cancer stem cells are a very small number of cells in the tumor responsible for tumor growth.

Q: Why are population sizes not constant in biology?

A: There are phases in population growth. The population growth can't always be exponential (…

Q: Which of the following joints can be considered as never moves type? A) Fibrous joints B) Synostosis…

A: Introduction Joints are formed when different bones connect with others. Most joints allow the…

Q: Question 10 Which of the following statements is incorrect? O In delta notation of fatty acid…

A: Q. Which of the following statements is incorrect? 1.In delta notation of fatty acid…

Q: 12 Vertebrates Deuterostomes other Lophotrochozoa other Arthropods Mollusks Radiata Porifera Fungi…

A: Taxonomic distribution of the species found in the Rabosky's study.

Q: The somatic nervous system provides both excitatory and inhibitory signals t skeletal muscle. True…

A: Neurons are the structural and functional units of the nervous system. A neuron consists of the…

Q: What is the effect of linkage and recombination on gamete genotypes?

A: Nucleus is a main controller of the cell which comprises of thread like structure known as…

Q: Describe the type and strength of the relationship between number of chicks and predators. positive,…

A: Correlation coefficients are numerical measurement that determines the strength of a relationship…

Q: ividuals who are heterozygous for both eye color and hair form are said to be doubly heterozygous,…

A: Introduction In the mid-nineteenth century, Gregor Johann Mendel was the first to uncover the basic…

Q: Figure

A: The cross of the yellow round seeds with the wrinkled green is a type of dihybrid cross. The ratio…

Q: 22. A rat mother is a high licker/groomer. Her offspring will display: a. Low levels of…

A: The glucocorticoid receptor is an evolutionally conserved nuclear receptor to which cortisol and…

Q: A perfect flower is one in which both ________ and ______________ are present.

A: Flower The flower is defined as the reproductive part of the plant which contains male and female…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: 1. What are the reasons why Philippine tarsiers cannot be found in Cebu despite it being near to…

A: The Philippine Tarsiers are endemic to Philippines. They are majorly found in the islands of Samar,…

Q: Skeletal muscles account for approximately 43% of the typical body mass. At rest, they use about 18%…

A: Skeletal muscles account for approximately 43% of the typical body mass. At rest, they use about 18%…

Q: Briefly discuss (using three sentences) how the concepts and/or techniques in molecular biology are…

A: Introduction Molecular biology:- It is the branch of biology that studies the molecular basis of…

Q: 41. In acute prostatitis, an exam of the prostate may find the gland to be: A. Nodular B. Cool and…

A: Please follow step 2 for detailed explanation.

Q: How are the structures of the pistil and stamen adapted for successful fertilization?

A: Flowers are angiosperm organs that specialize in sexual reproduction. Flowers are specialized organs…

Q: Question 4 In ducks, the allele for black feathers (B) is co-dominant with the allele for white…

A: Alleles Alleles are the two different varieties of same gene for example height is gene and long and…

Q: What is a dominant trait? Recessive trait? 2. Differentiate monohybrid cross from dihybrid cross. 3.…

A: Mendel is knows as the father of genetics. Genetics is the study of genes and heredity. Disclaimer…

Q: The following graph shows the AMPA/NMDA ratio in cells from rats that were either: naive, unpaired…

A: NMDA and AMPA are one types of glutamate receptors mainly present in neuron.

Q: F1 mice targeted using CRISPR/Cas9 and an HDR DNA fragment is the first choice when modeling a.…

A: During replication, there will be a tiny number of mistakes in the sequence every time this happens.…

Q: A correlation between two variables implies that ... one variable may or may not directly affect the…

A: ANSWER;-d) One variable directly affects the other variable. Explain;- Connection is a factual…

Q: Why are there so many serotypes of the same bacterial parent strain? O Mutability O Genetics All…

A: Serotype A group of same species having distinct surface antigen receptors.

Q: What is the importance and advanatge of detecting CSCs? Please explain in detail the main findings…

A: Cancer is a collection of disorders characterized by abnormal cell proliferation with the capacity…

Q: Suppose that in maroon-fronted parrots, the number of chicks born each year in a population is…

A: Competition is a interaction between species that happens when two or more species require the same…

Q: Q3. Using the mutated DNA parental template sequence, follow it through to the resulting polypeptide…

A: The gene or small portion of DNA undegoes transciption to form mRNA and then this mRNA undergoes…

Q: Consider the following graph of an action potential: 60- 30- membrane potential (mV) O -30- -60 line…

A: Action potential refers to the sudden rise and fall of membrane potential across a cellular membrane…

Q: What are some of the functional and evolutionary advantages of gnathostomes?

A: Gnathostomes are vertebrates that have jaws. Having jaws has an evolutionary advantage for this…

Concept explainers

Human Evolution

Human evolution is the process of evolution of humans from early man to anatomically modern humans. The process of evolution in humans leads to the gradual development of traits like bipedalism. Humans are the highly social animals that make them the most advanced animal on Earth. Human evolution is an outcome of interaction among the following processes:

Question

1. How does genetic drift affect human evolution? Discuss it and present possible evidences.

Do no just copy from somewhere, please.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. What could be the possible roles of genetic drift in human evolution? Discuss it and show possible evidences for each role. Do not just copy it from somewhere, please.
1. What could be the possible roles of genetic drift in human evolution? Discuss it thoroughly and present possible evidences for these roles. Do not just copy it from somewhere, please.
1. Does genetic drift affect natural selection? Yes or No? Discuss and explain it thoroughly. Do not just copy it from somewhere, please.
1. Present possible evidences that genetic drift affect human population. Discuss this evidences comprehesively. Do not just copy from somewhere, I need evidences that shows that genetic drift has a role in human evolution. Thank you!
Which statement about analogies is correct? They occur only as errors They are synonymous with homologous traits. They are derived by similar environmental constraints. They are a form of mutation.
One of the original Amish colonies rose from a ship of colonists that came from Europe. The ship s captain, who had polydactyly, a rare dominant trait, was one of the original colonists. Today, we see a much higher frequency of polydactyly in the Amish population. This is an example of: natural selection genetic drift founder effect b and c
1. Does genetic drift affect natural selection and does natural selection affect genetic drift. Explain it thoroughly and in an understable way. Do not just copy it from somewhere.
5. a. Is genetic drift a gain or loss in heterozygosity? b. What population is most effected by drift? Ne = 20 or Ne = 200. Why? c. There is a balancing act between drift and another force of evolution. What is it and why is this important?
1. a) How does this experiment demonstrate the definition of evolution? b) Fitness of organisms is a function of the environment (that is, organisms best fit to the local environmental conditions leave more surviving offspring). How does this experiment demonstrate this fact?
2. What is the role of variation in evolution – if heterozygosity is reduced, what happens to the potential for evolution? The phenotype (and genotype) of a population is due to a "mosaic" of random and directed processes. Some of these have to do with history; some are related to adaptation, etc. As completely as possible, discuss the role of chance and direction in evolution and in determining the phenotype of a population.
2)Which of the following describe examples where the mechanism of evolution was genetic drift? Choose all that apply a)A rock slide kills some of the lizards in a desert population b)Drought conditions cause trees that do not have sufficiently deep root systems to die off c)A group of squirrels float on a raft of debris from northern Missouri to southern Arkansas during a major flood on the Mississippi River d)A few ground squirrels use a fallen log to cross a river that divides two populations e)Lava flowing from a volcanic eruption in Hawaii separates a population of fish into two newly-formed bays
1. Artificial Selection• Explain how artificial selection is like natural selection.• Why are quail useful subjects for an experiment on selection? What other organisms share similar characteristics?