Answered: 1. How many MOLECULES of water are…

1. How many MOLECULES of water are present in 3.00 moles of this compound ? molecules. 2. How many MOLES of water are present in 5.67x1022 molecules of this compound ? moles.

Chemistry

9th Edition

ISBN:9781133611097

Author:Steven S. Zumdahl

Publisher:Steven S. Zumdahl

Chapter3: Stoichiometry

Section: Chapter Questions

Problem 54E: What amount (moles) of compound is present in 1.00 g of each of the compounds in Exercise 52?

See similar textbooks

Related questions

Q: Magnesium metal reacts with aqueous sulfuric acid solution to produce magnesium sulfate (in solution...

A: an increase in oxidation number means oxidation a decrease in the oxidation number means the reduct...

Q: H2 2 initial rate of reaction 1.23M 1.18M 4.00 × 10°M/s 0.381M 1.18M 1.24 x 10°M/s 1.23M |3.10M 1.05...

A: Given Concentration of reactants Initial Rate of reaction What have to determine ? Rate law exp...

Q: In the replacement reaction of magnesium nitrate with tin, how many grams of magnesium would be prod...

Q: The activation energy for a certain reaction is -164 kJ/mol. If the rate constant is 117 M-1 s-1 at...

Q: What is the correct chemical waste of Ammonia and Diethylamine A. Down the sink B. Con...

A: Answer :

Q: Is the following, C20,2 CO22, an oxidation or a reduction half-reaction? eTextbook and Media Save fo...

Q: Suppose a 3.00 L scuba tank is filled with about 29.7 moles of air at the ocean surface. If the tank...

Q: The equilibrium constant, Kp, for the following reaction is 1.57 at 600 K: CO(g) + Cl2(g) coCI,(g) C...

Q: Calculate the average atomic mass of Amazium, a newly discovered element (Amazium, symbol Az) which ...

A: Given :- There are only 2 naturally occurring isotopes of Amazium. Mass of isotope Az-230 = 229.995 ...

Q: 1. Give a full description (type -purine/pyrimidine- name adenine/guanine/uracil/thymine/cytosine, w...

A: This question is related to biomolecules. Bases are divided in to two categories Purines Pyrimidine

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...

Q: Balance the given equation using half – reaction method (electron transfer method). Crl3 + H2S Crl2 ...

A: Chromium is reduced, sulpher is reduced and Hydrogen is oxidised.

Q: 30- 25 22.285 20- atm 15 10- 5- 50 100 150 200 250 300 seconds created Is BF, being created or destr...

Q: molar ratio

Q: e partial pressure of S

Q: Estimate the λmax of the following organic compounds. Show your solutions and/or analysis.

A: Woodward–Fieser rules: The Woodward–Fieser rules are used for the calculation of the wavelength of t...

Q: molar mass

Q: POSSIBLE NagPO4 + Baclz - Baş(PO42 + Naci How many moles of BaClz are needed to make 2.50 moles of N...

Q: Compute the charge of the following ions. 1.) Ion with a charge of -2 2.) Ion with a charge of +5

A: An electron is a subatomic particle with an electric charge equal to 1.602 × 10-19 coulomb in magnit...

Q: Part A An iron ore sample contains Fe2 O3 together with other substances. Reaction of the ore with C...

A: To balance the equation we have to balance the number of each atom on both reactant and product side...

Q: [N:] [H] initial rate of reaction 2.41M 2.25M 0.489M/s 6.14M 2.25M 1.25M/s 2.41M 4.49М 1.95M/s Use t...

A: rate = k [N2]m [H2]n k = rate constant m = order of reaction with respect to N2 n = order of rea...

Q: 7.) Use the following thermochemical equations as needed to find the heat of formation of diamond: C...

A: We can solve this problem using this concept, Graphite and diamond are in equilibrium state at their...

Q: 1. How many MOLECULES of phosphorus trichloride are present in 4.58 moles of this compound ? molecul...

Q: Some measurements of the initial rate of a certain reaction are given in the table below. [N:] H2|in...

Q: The pectral data below i8 for a Compaund once OSed as a riot Control agunt, that is no longer due to...

Q: 4. A compound melting at 134°C was suspected to be either aspirin (mp 135°C) or urea (mp 133°C). Exp...

A: Solution Given That A unknown compound melting point is 134 °C. As...

Q: 1. How many MOLES of boron trichloride are present in 4.21 grams of this compound ? moles. 2. How ma...

Q: 1. 2. 3. 1. 3. 3. 2. M NaHSo 18.5 second lowing ermining the Rate Law for a Chemical Reaction ata Sh...

Q: Problem 42 C13H9NO3 Problem 42 - 'H NMR spectrum (CDC13, 500 MHz) MW = 227 2H =, CDC13 2H =, CDCI; 1...

A: NMR spectroscopy measures the effect of external magnetic field on the nuclei and helps in analysis ...

Q: t a certain temperature this reaction follows second-order kinetics with a rate constant of 1.47M CI...

A: Given Reaction followed second order kinetics

Q: Unknown compound D has a melting point of 102-103 degrees C. Carbon/ Hydrogen analysis of compound D...

Q: Why cannot oils and water-soluble products be mixed and heated together? Why should heating be at a...

A: Oils and fats are non-polar compound (hydrocarbon) and water is non-polar compound and water molecul...

Q: What is the oxidation state for KMnO4? Please show or explain calculation

Q: Consider the following table: Name Formula Conjugate Acid 1.8 x 10 5 4.38 х 10 4 NH3 NH,+ Ammonia Me...

A: For best buffer solution pH of the solution should be equal to pKa of acid. For effective buffer so...

Q: The equilibrium constant, Ka, for the following reaction is 1.29x10-2 at 600 K. coCI2(g) co(g) + Cl2...

A: The balanced equilibrium reaction given is COCl2 (g) ⇌ CO (g) + Cl2 (g) The equilibrium constant K...

Q: Chemistry: Bonding 1. a. Identify and describe the type of bonding present in BaCl2. b. What is th...

A: Types of bonds: 1) Covalent bond: Covalent bond is formed by the mutual sharing of electrons the t...

Q: Consider the species HC4H406-, C4H4062-, derivatives of tartaric acid. Each ion can act as base in w...

Q: H3C H. OH

A: Here we have to determine the product formed by one time oxidation of the following given compounds....

Q: Complete the table below for calculating the molar mass of the ionic compound chromium(II) sulfide. ...

A: Given, Chromium (II) sulfide.

Q: 6KNO3 How many moles of KNO, qre Produced If 439 of Ni(NO,)3 reacts

Q: Part A ОН Br Spell out the full name of the compound. 7-bromo-6-ethyldecan-5-ol Submit Previous Answ...

Q: Briefly discuss the four ICH-recognized climactic zones.

A: Basis of classification of zones as per ICH guidelines The zone classification is based on the temp...

Q: Draw the Lewis diagram and a resulting structural diagram to represent each of the following: One c...

A: Since you asked multiple questions so as per Q&A guidelines of portal I solved first question,be...

Q: 1. In a combustion process of a coal-fired power plant, 20% excess of the theoretical amount of Oxyg...

A: Answer is below

Q: Part A Consider the reaction: CO(g) + 2H2(g) = CH;OH(9) What is the value of the equilibrium constan...

A: Determine equilibrium constant of the given reaction ----

Q: Some measurements of the initial rate of a certain reaction are given in the table below. H2 2 initi...

A: The sum of the exponent term in the rate law for a chemical reaction is known as the order of the re...

Q: Determine the point group of the following orbital:

Q: Under certain conditions the rate of this reaction is zero order in dinitrogen monoxide with a rate ...

A: The integrated rate equation for a zero order reaction is, [ C ]t = -kt + [ C ]0 [ C ]t = Co...

Q: When calibrating a pH meter, 3 (three) standard color-coded buffer solutions are used, which of thes...

A: The correct answer about PH calibration is given below

Q: What is that the entropy change of the universe (J/mol-K) when the entropy change of the system is 7...

Concept explainers

Mole Concept

Mole concept is a method to determine the amount of any substance that consists of some elemental particles using a grouping unit called ‘mole’. The mole concept enables one to handle the large amount of small elementary particles. The mole concept can be used in many calculations related to mole calculation, molar amount, mole ratio, and so on, which are significant in chemistry.

Question

1. How many MOLECULES of water are present in 3.00 moles of this compound ?
molecules.
2. How many MOLES of water are present in 5.67x1022 molecules of this compound ?
moles.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1b

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

What number of molecules (or formula units) are present in 1.00 g of each of the compounds in Exercise 51?
Calculate the number of molecules present in each of the following samples. l type="a"> 4.75 mmol of phosphine, PH3 i>4.75 g of phosphine, PH3 i>1.25102 g of lead(II) acetate, Pb( CH3 CO2)2 i>1.25 X 10 2 moles of lead(II) acetate, Pb( CH3 CO2)2 i>a sample of benzene, C6H6 , which contains a total of 5.40 moles of carbon
f you have equal mole samples of NO2 and F2 , which of the following must be true? l type='a'> The number of molecules in each sample is the same. i>The number of atoms in each sample is the same. i>The masses of the samples are the same. i>6.0221023 molecules are present in each sample.
What mass of compound is present in 5.00 moles of each of the compounds in Exercise 52?
Write a sentence that describes how to determine the number of moles of a compound in a known mass of the compound if we know its molecular formula.
Considering your answer to Exercise 79, which type of formula, empirical or molecular, can be obtained from elemental analysis that gives percent composition?
Freon- 12 (CCI2F2) is used as a refrigerant in air conditioners and as a propellant in aerosol cans. Calculate the number of molecules of Freon-12 in 5.56 mg of Freon-12. What is the mass of chlorine in 5.56 mg of Freon-12?
What amount (moles) of compound is present in 1.00 g of each of the compounds in Exercise 52?
Describe an experiment that would enable someone to determine the percentages of carbon and hydrogen in a sample of a newly prepared hydrocarbon.
What information do we need to determine the molecular formula of a compound from the empirical formula?
Complete the following table. l> Mass of Sample Moles of Sample Molecules in Sample Atoms in Sample 4.24 g msp;C6H6 0.224 mol msp;H2O msp;2.711022 molecules msp;CO2 1.26 mol HCl td> msp;2.211024 molecules msp;H2O 0.297 g msp;CH3OH
3.78 Consider two samples of liquid: I mole of water (H2O) and 1 mole of ethanol. Answer each of the following questions. Note that none of these should require significant calculations. (a) Which sample contains more atoms? (b) Which sample contains more molecules? (c) Which sample has a larger mass?