1. Stages of the insulin biosynthesis and maturation. Components: A. N-terminal amino acid. B. N-signal peptide. C. Preproinsulin. D. Proinsulin. E. C-peptide. Vi pcummem Сеченова пенный 2) I. Ceuenosa
Q: Substrate A occupies the active site of an enzyme. However, inhibitor XY occupies a region in the…
A: Enzymes are catalyst which only accelarate the reactions but doesn't take part in reaction. So after…
Q: What is the dna strand sequence for phosphate sugar backbone?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which of the following has the strongest tendency to gain electrons? Select one: O a. FAD O b.…
A: The electrons released from NADH and FADH2 are transferred to molecular oxygen in ETC to generate a…
Q: What types of monomers make up a carbohydrate? What are carbohydrate polymers called?
A: Carbohydrates are biomolecules made up of carbon, hydrogen, and oxygen. The ratio of H and O is the…
Q: While fatty acids are most often formed by the condensation of_-carbon units, isoprenoids are…
A: Fatty acid and isoprenoid both are class of lipid and plays an important role in the metabolism of…
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: What part of the protein sequence leads to different functions
A: Proteins are peptides , composed of monomers of polymers,Protein function is directly related to the…
Q: Question 23 18:1cA9 O w-9 fatty acid O oleic acid
A: Polyunsaturated fats, such as omega-3 fatty acids, are a form of fat that body cannot produce.…
Q: Which pathway uses glucose 6-phosphate to produce NADPH, ribose 5-phosphate, and other sugar…
A: Major metabolic pathways of carbohydrates are glycolysis, TCA cycle, gluconeogenesis, glycogenesis,…
Q: When the blood glucose is low, insulin is released from the pancreas to maintain glucose…
A: Introduction: Homeostasis is the maintenance of a stable internal environment within an organism,…
Q: Question 3 Aldosterone regulates sodium, potassium, and chloride ions in tissues True False
A: Aldosterone is a hormone which is secreted by the adrenal glands. Aldosterone secretion is increase…
Q: The reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase involves two "sub-reactions", one…
A: A mole of NAD is reduced to NADH by glyceraldehyde phosphate dehydrogenase, resulting in…
Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…
A: Okazaki fragments are short stretches of DNA on the lagging strand, which is synthesized in the…
Q: A. They carry unneeded cholesterol back to the body's liver, where it is eliminated. 7. Which…
A: Lipids are amphipathic molecules that contain both polar and non-polar parts present in them. Lipids…
Q: 1. How is PKD inherited? What gene is responsible for the expression of PK enzyme ?
A: Pyruvate kinase deficiency is an inherited lack of the pyruvate kinase, that gets used by red blood…
Q: Describe three important health disorders or diseases related to abnormal cholesterol metabolism
A: Cholesterol is a class of certain organic molecules which is found in the body of living organisms.…
Q: Principle involved in the isolation of gluten * (Please choose one correct answer only) A.…
A: The protein component of wheat flour is called Gluten. This basic component gives elasticity and…
Q: With Fehling's reagent (under certain conditions) interact: A. Glucose B. Quinine hydrochloride C.…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: A mixture of Asparagine (pl 5.41) , Aspartic Acid (pl 2.98), Histidine (pl 7.59), Lysine (pl 9.74)…
A: Cation exchange chromatography separates the molecules based on their net negative charge. Cation…
Q: Which of the following is the CORRECT relationship?
A: Phosphatidylinositol 4, 5 bisphosphate is known as PIP2 that is a component of cell membrane -…
Q: The pH vs charge graph for a triprotic amino acid is shown below. Please answer the following…
A: An amino acid with the ability to donate 3 protons (3 H+) is called a triprotic amino acid. The 3…
Q: 2. Compound 1 below is metabolized to compound 2 by CYP. The enzyme is gradually inactivated during…
A: Cytochrome P450 are a class of proteins with the ability to catalyze oxidation reactions. They…
Q: How are water-soluble vitamins different from fat-soluble? * (Please choose one correct answer only)…
A: Vitamins are essential nutrients required for the body to fight against diseases. There are two…
Q: In a double-stranded DNA molecule, how are the sequences of each strand related to each other? A…
A: DNA are the nucleotide which contains genetic information in our body and are found in nucleus.
Q: The herbicide glyphosate (Roundup®) kills plants. Discuss all the Biochemistry involved as to why…
A: Herbicides are the chemicals used to kill unwanted species of plants growing around the…
Q: List the microbial targets of disinfecting chemicals, how that affects the microbe, and provide one…
A: The Environmental Protection Agency (EPA) registered disinfecting agents as antimicrobial…
Q: Given Ribose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Ribose is a simple sugar and carbohydrate. Ribose, also called D-ribose is a five-carbon sugar found…
Q: Which of the following is NOT a primary method used to regulate the activity of cyclin-dependent…
A: Cyclin-dependent kinases (CDKs) are the protein kinases which plays a role in regulating the cell…
Q: Compare and contrast DNA replication and PCR.
A: Dna replication is the process of Synthesis of new daughter dna molecules or duplication of parent…
Q: Many malignant tumors are characterized by the activation of one or more growth-factor receptors.…
A: Malignant tumours (or "cancers") are classified as monoclonal, which means that each tumour develops…
Q: Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Raffinose is a trisaccharide of glucose, galactose and fructose in which glucose acts as a bridge…
Q: The circulatory system is a O closed network of arteries, veins, and capillaries O an open network…
A: Circulatory system is one of the important systems of the body involved in various processes like,…
Q: a) Which catalytic mechanism occurs in step 2? b) Why must phosphate first bind to succinyl-CoA…
A: Glycolysis, TCA cycle, and ETC all are interconnected processes. Respiration is an oxidative…
Q: What is the usual product of fatty acid synthase in the cytoplasm? palmitate oleate stearate 4…
A: Introduction: The synthesis and degradation of fatty acids take place through different pathways. It…
Q: Three sugars (Sugar A, Band C) were applied to a line as part of the set-up of a Paper…
A: Paper chromatography is the basic technique to separate dissolved chemical substances from the…
Q: 6. When a concentrated alkali solution acts on the purine cycle, it breaks down: A. Ester group B.…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: Question 5 CH3(CH2)14–Ċ-0–CH2-(CH2)28-CH3 Palmitic acid Triacontanol
A: Lipids are a class of biomolecules that are mostly dissolved in organic solvent and contains a…
Q: S. Why are histamine and serotonin contents increased in the site ol inilammatory? Explain the…
A: Histamine is an organic nitrogenous compound which is synthesized from amino acid residue…
Q: What carbohydrate is generally detected using the Molisch test? *
A: Carbohydrates are polyhydroxy aldehydes or ketones commonly called as sugars or saccharides.…
Q: 3. How do erythrocytes produce ATP? What is the role of ATP to red-cell morphology and function
A: Adenosine triphosphate (ATP) is an energy-carrying molecule particularly found in the cells of all…
Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: Pyruvate kinase is an glycolytic enzyme, which catalyzes the conversion of phosphoenolpyruvate (PEP)…
Q: Match the following lipids with their functions
A: Lipids are the various organic compounds which are insoluble in water. These are- fats, waxes,…
Q: How to calculate the amount of myoglobin in grams from a 2.0 ml sample of protein extract???
A: Beer Lamberts law states that value of Absorption at a particular wavelength of light by an analyte…
Q: c. (i) Which enzyme in prokaryotes synthesizes the primers? On which strand (leading or lagging…
A: DNA replication, or copying of a cell's DNA, is semiconservative, which means that each strand of…
Q: Match the following descriptions to the given choices…
A: Vitamin - The organic molecule and an essential micronutrient which is required by any organism in…
Q: Vhich of the following glycerophospholipid has a phosphate ester attached to a sugar moiety? O…
A: Introduction: Glycerophospholipids are the most abundant lipids present in the cell membranes. The…
Q: d) Which reactions are predicted to be far-from-equilibrium? Explain your rationale. e) What type of…
A: Glyoxylate cycle is an anabolic pathway that occurred in plants, bacteria, protists, and fungi in…
Q: What is enzyme specificity?
A: The metabolic processes involve several metabolic pathways each with several chemical reactions…
Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…
A: The genetic material in most organism is double stranded DNA with the two strands running in…
Step by step
Solved in 3 steps
- Which of the following statements concerning insulin is NOT true? a. Insulin can increase glycogen synthesis. b. The presence of insulin can increase glucose uptake. c. Insulin can increase the secretion of epinephrine. d. It is secreted by the beta cell of pancreas. e. Glucose in blood can up-regulate the secretion of insulin.A. What is the difference between preproinsulin and proinsulin? B. What is cleaved out of proinsulin to allow the mature insulin molecule to be formed? C. What is the C peptide and why is it medically significant? D. What is the purpose of the signal sequence and why isn’t it present in the mature insulin molecule?Which of these statements about the hormone insulin is true? a.It is secreted by alpha cells in the pancreatic islets. b.It is secreted in response to a rise in blood glucose. c.It stimulates the production of glycogen and fat. d.Both a and b are true. e.Both b and c are true.
- Distinguish the difference of the mechanism of insulin insufficient DM and insulin resistance DM.It is noticed that when a strain of mice exercises, their blood glucose drops to very low levels. Which of the following can explain this situation? a) These mice do not make enough insulin b) these mice lack insulin receptors on their cells c)these mice lack glucagon d) these mice cannot synthesize glycogen from glucoseWhich of the following statements about insulin is not true? a. The insulin receptor has tyrosine kinase activity. b. Insulin increases fat synthesis in adipose cells. c. Insulin increases glycogen synthesis d. Insulin increases gluconeogenesis reactions.
- Discuss the following statement: “We wouldhave no idea today of the importance of insulin as a reg-ulatory hormone if its absence were not associated withthe human disease diabetes. It is the dramatic conse-quences of its absence that focused early efforts on theidentification of insulin and the study of its normal role inphysiology.”A doctor has three patients who he suspects may be diabetic. On two occasions, each patient was administered a sugar test (i.e., was asked to consume a very sugary beverage) and their blood sugar levels were monitored for 120 minutes according to the graphs shown below. a) Which of the three patients does not have diabetes? How do you know? b) Which of the three patients has Type I diabetes? How do you know? c) Which of the three patients has Type II diabetes? How do you know?A certain type of tumor results in the overproduction of glucagon. Researchers claim that treatment with insulin can counteract the effects of the excess glucagon . Provide reasoning to justify the researchers' claim.
- Which of the following correctly describes the hormone insulin? a. It is produced by B cells in the pancreas. b. It increases glucose uptake by liver and muscle cells. c. It is a peptide hormone. d. It lowers blood glucose levels. e. All of these are correct.Discuss and trace the pathway of the production of insulin, starting from the stimulation by glucose.The insulin that does not have a peak of action is:A. Glulisin (Apidra)B. Glargine (Lantus)C. Isophane (Protaphane)D. Biphasic Insulin N 70/30E. Aspart (Novolog)