Many malignant tumors are characterized by the activation of one or more growth-factor receptors. What is the catalytic activity associated with transmembrane growth factor receptors such as the EGF receptor?

Q: Pioglitazone, a drug used to treat diabetes, causes some membrane-embedded portions of mitochondrial…

A: Complex I is the largest multi-subunit complex of Mitochondrial Respiratory Chain (MRC), that causes…

Q: 1. A sigmoidal plot of substrate concentration ([S]) verses reaction velocity (V) may indicate: (A)…

A: Hi. Thank you for the question. As per the honor code, We are allowed to answer three sub-parts at a…

Q: Among the simplest_ , those called_, are glucose (an_) and _(a _).

A: Glucose is simple sugar which is present in body having molecular formula C6H12O6.Glucose is…

Q: Failed to follow

A: Waxes are a broad category of organic compounds that are lipophilic and bendable solids at room…

Q: Explained how metal ions help in enzyme action. Cite three vitamins that have antioxidant activities

A: The process of translation takes place in the cytoplasm which converts mRNA to…

Q: of sodium and potassium (that leads to hyponatremia and hypokalemia), hypocalcemia and ostcoporosis,…

A: In butler Albright syndrome Patients suffering from renal tubular acidosis, nephrocalcinosis, and…

Q: Cleavage of a phosphate bond is needed for de-polymerization of which mature polymer? Neither…

A: The eukaryotic cytoskeleton is composed of microfilaments, microtubules, and intermediate filaments.…

Q: I. Effect of pH on ezyme activity pH Test tube Observation I 2 4 4 5 12 Conclusion: 8. 3.

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…

A: DNA strand given here with directionality is as: 5’…

Q: For the ion concentrations in Table 12.1, calculate the equilibriumpotentials for each ion species…

A: ions can move in either direction through a channel (i.e., either into or out of the cell) the…

Q: What are examples of indirect and direct contact to soil. Please give 10 each. Thank you

A: Soil is an essential part of life. living organisms need food for their survival which is obtained…

Q: What assay could be used to test the function of a protein in the glycoside hydrolase family?

A: Glycoside hydrolases are enzymes that catalyze the hydrolysis of the glycosidic linkage of…

Q: Draw the structure of following peptide: Glu-Asp-His-Cys-Gly-Arg (B) At pH= 10.7 (A) At pH= 2.1

A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide…

Q: Test Results + or -? Points awarded Code Glu – acidic end products yellow ______ _____+ Glu – gas…

A: Introduction: Microbial metabolic processes are complex but still, it permits the microbiologist to…

Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions…

A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…

Q: In generating CO2, how can the citric acid cycle discriminate between the carbons in citrate given…

A: In the first phase of the citric acid cycle, acetyl CoA combines with oxaloacetate, a four-carbon…

Q: Which of the below statements is correct regarding tertiary structure? All are correct Disulfide…

A: A protein has four structural levels of organization – primary, secondary, tertiary and quaternary…

Q: Which two enzymes produce reducing equivalents without a loss of carbon in the TCA cycle? O…

A: Question 19: Two enzyme that produce reducing equivalent without the loss of carbon in TCA cycle…

Q: 7. A 22-year-old patient suffering argininosuccinic aciduria from little was prescribed the…

A: Arginosuccinic aciduria is a genetic disorder of the urea cycle.  a) Scheme of ammonia…

Q: Drug A has an half-live of 6 hours, a volume of distribution of 40 liters, and a bioavailability…

A: Total body clearance is defined as the volume of blood from which all drugs are removed per minute…

Q: Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the following…

A: In eukaryotes, the genomic DNA is present in the nucleus. The process of transcription in the case…

Q: In kappa and iota carrageenans, gels are formed through double helical formation of two…

A: Carrageenans are polysaccharides comprised of repeating disaccharide units of sulfate derivatives…

Q: INSTRUCTIONS • Answer properly! • Do not copy on Google. Distinguish between the tertiary and…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: explain with proper details please. Compare the net production of ATP from four molecules of…

A: Glucose is a carbohydrate and it is degraded into carbon dioxide through glycolysis, pyruvate…

Q: What is the purpose of DNA methylation? Why is it ineffective in the DNA repair of spontaneous…

A: DNA methylation is the process of adding methyl groups to DNA at Nucleotide bases, so that without…

Q: ng glycolysis, t

A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If…

Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…

A: Ezymes are boost up chemical reaction in body.allosteirc enzyme are type of Ezymes.Allosteric enzyme…

Q: write about a Famous Case of someone with Li-Fraumeni Syndrome

A: Li-Fraumeni syndrome is a rare hereditary disorder that predisposes carriers to cancer development.…

Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…

A: Reaction catalyzed by Pyruvate carboxylase is given below; Pyruvate + CO2 + ATP + H2O →Pyruvate…

Q: Lecithins and cephalins are both

A: Lecithin are mixture of glycerophospholipids like phosphatidylcholine, phosphatidylethanolamine,…

Q: Fermentation occurs when is in too scarce amount to continue Its purpose is to re-generate so that…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: b. Two different liposomes have radii of 50.00 nm and 70.00 nm respectively. In a biopolymer…

A: Introduction: Liposomes are simple microscopic vesicles in which aqueous volume is enclosed entirely…

Q: Eukaryotic polymerases have the same number of subunits as prokaryotic ones.   True False

A: The process of creating an RNA copy of a gene sequence is known as transcription. The copy is known…

Q: Explain to me what factors influence permeability versus solubility?

A: To understand the factors effecting the solubility and permeability it is essential to understand…

Q: What are nucleic acids?

A: Carbohydrates, proteins, lipids, and nucleic acids are the four biomolecules, which are essential…

Q: Q1: Explain the effect of pH value on the amino acid ionization. Q2: Describe two reactions for…

A: Amino acids and their ionization: Amino acids are the basic building blocks of proteins, they are…

Q: Transcription in eukaryotic cells which is resistant to α-amanitin is carried out by which RNA…

A: RNA ploymerase arr the enzymes that synthesize RNA by reading the DNA strand. It copies DNA sequence…

Q: The limit for G-200 beads is 5000-600,000. When you pass two proteins- Protein A (75, 000), Protein…

A: Proteins are amazing molecules that make everything simple inside the cell. Proteins molecules are…

Q: 3. A 15-year-old boy presented with a history of episodic vomiting associated with subacute…

A: We get most of the nitrogen that we need via eating proteins. The nitrogen that we get from these…

Q: 1. To investigate the physical properties and uses of some common aldehydes and ketones. 2. To…

A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the…

Q: In polynucleotides, the phosphodiester bond is  between the ______.   a   3’ OH from the 3’ end,…

A:

Q: separating gel

A: here they talk about ion exchange chromatography and electrophoresis. Ion exchange chromatography…

Q: 6. DNA electrophoresis uses polyacrylamide gel for separation. a) True b) False 7. Agarose is a…

A: DNA is composed of nucleotides attached via phosphodiester bonds. DNA act as genetic material in…

Q: estion properly and accordingl

A: Saponification is the process of forming a metallic salt of a fatty acid, which is referred to as a…

Q: A polypeptide with a net positive charge at physiologic pH (~7.4) most likely contains amino acids…

A: The pKa values of the side chains of amino acids determine the net charge on a protein at a…

Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for…

A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's…

Q: unfold the protein

A: here they are talking about protein unfolding. The tension applied by the cantilever during protein…

Q: An effort is usually made to purify a protein fırst, before its characteristics are determined. True…

A: Purification of a protein is done to get the interested protein in as native form it can be.…

Q: The molecule shown below is NH2 HO N. Но но

A: Deoxyribonucleic acid (DNA) is a molecule comprised of two polynucleotide chains that wrap around…

Metabolic pathways

Metabolism is defined as the group of life-supporting, enzyme-mediated chemical reactions in organisms. A metabolic pathway is a set of these chemical reactions that involve anabolism (synthesis of complex biomolecules) and catabolism (breakdown of biomolecules into small molecules) that occur inside a cell. Metabolites are the reacting substances, products, and intermediate substances of an enzymatic process that are altered by a series of chemical events catalyzed by enzymes.