Answer all 1-13 Multiple Choice. Choose the letter of the best answer. Write the chosen letter on youranswer sheet.1. What is called the functional unit of a DNA molecule that may code for RNA orprotein?A. amino acidB. chromosome2. Where does RNA transcription occur?A. cytoplasmB. nucleus3. If DNA is described as a double helix. how should MRNA be described?A. a double strandB. a single strand4. How many bases are needed to specify an mRNA codon?A. 15. It carries genetic information in the cell and is capable of self-replicat.ion. Whichof the following is the correct answer?A. DNA6. The following is the base sequence on one strand of a DNA molecule:TGC AAT CAG TGTIf this strand is replicat.ed. which of the following is the complement.ary strandthat is produced?A. TCG UUA GTC ACTB. ACG UUA GUC ACAC. chromatinD. genesC. loumn-D. ribosomesC. a tripletD. a quadrupledВ. 2С.3D. 4B. MRNAC. PRNAD. LRNAC. ACG TTA GTC ACAD. AGC TTA GTC ACAUSE THE SAME BASE SEQUENCE IN ITEM NUMBER 6 TO ANSWER ITEMS I AND 8.1. Iftranscribed int.o an MRNA, what would be the resulting strand?C. UGC AAT CAT UGUA. ACG TTA GTC ACAB. ACG UUA GUC ACAD. AGC TTU GTC ACA8. During Translation. the LRNA sequence of nucleotides arranged linearly isWhich of the following is the correct answer?C. TGC AAT CAT UGUD. UGC UAT CAG UGUA. UGC AAU CAG UGUB. TGC AAT CAG TGTUSE THE GENETIC CODE TABLE TO ANSWER ITEMS 9 TO 11.9. The codon ACG is for which amino acid?A. AlanineB. Arginine10. The codon for Methionine is -----A. AUG11. What is the amino acid sequence for the resulting MRNA strand in item numberC. ThreonineD. ThymineWhich is the correct answer?B. AUCC. AUAD. AGT1?A. Threonine-Leucine-Valine-ThreonineB. Threonine-Ualine-Leucine-ThreonineC.Methionine-Threonine-Leucine-UalineD. Valine-Threonine-Alanine-Lysine12. What happena during the elongation stage of translat.ion?A. Ribosome reaches a stop codon.B. LRNA molecule carries the amino acid.Ribosomes continue Lo translate each codon.D. New protein is then released, and the translation complex cornes apart.13. Which of the following is the role of DNA in protein synthesis?A. DNA transcribed into RNA.B. Directs the synthesis of protein.C. Translate a codon into an amino acid.D. Produce identical copies that is copied into a protein product.

DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino acid B. chromosome 2. Where does RNA transcription occur? A. cytoplasm C. chromatin D. genes C. L D. ribosomes B. nucleus 3. If DNA is described as a double helix, how should MRNA be described? A. a double strand B. a single strand C. a triplet D. a quadrupled

1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino acid B. chromosome 2. Where does RNA transcription occur? A. cytoplasm C. chromatin D. genes C. L D. ribosomes B. nucleus 3. If DNA is described as a double helix, how should MRNA be described? A. a double strand B. a single strand C. a triplet D. a quadrupled

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter3: The Chemistry Of Life: Organic Compounds

Section3.5: Nucleic Acids

Problem 1C: VISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label...

See similar textbooks

Similar questions

VISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.
Please ASAP. Thank you. Regarding the double helix of DNA, which of the following is true? a. Guanine pairs up with cytosine with three hydrogen bonds b. Complementary strands of DNA are held together by covalent bonds c. The backbone consists of ribose sugars H-bonded to phosphate groups d. Uracil pairs up with adenine with two hydrogen bonds
just choose dont explain The alternating sugar-phosphate backbone of the DNA is hydrophobic Select one: True False
INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
Which statements are true? Explain why or why not.1 Because the DNA double helix is only 2 nm wide—well below the limit of resolution of the light microscope—it is impossible to see chromosomes in living cells withoutspecial stains.2 A fluorescent molecule, having absorbed a singlephoton of light at one wavelength, always emits it at a longer wavelength.
BIOMOLECULES - MULTIPLE CHOICE - Please answer properly QUESTION : Which of the following processes occurs primarily to form dATP for DNA synthesis?? A. salvaging sing A-PRT B. de novo synthesis beginning with dPRPP C. converting ADP to dADP using thioredoxin D. all of the above
True or false ? Reactions in our cells happen in a perfect way, therefore DNA replication is error free
Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino Acids
PLEASE ANSWER WHY? Some substitution mutation result in a malfunctioning protein but others do not. Why is this?
I need help with a biology question The problem of replicating the lagging strand of DNA is solved through the use of Group of answer choices a. many RNA primers and multiple Okazaki fragments. b. the unwinding enzyme, helicase. c. base pairing. d. replication forks.
True/false? if false, justify briefly DNA synthesis during the S phase is extremely rapid. Cells undergoing the S phase are thus extremely sensitive to rays and chemicals.