Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3.5, Problem 1C
VISUALIZE Sketch a pyrimidine
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Draw the DNA and RNA models in Figure 1 in the space provided. Use the legend below to represent the colored plastic chips with letters. Use lines to connect the letter representations of the plastic chips according to how they are attached to each other in Figure 1. These lines represent thechemical bonds between the different nucleic acid subunits. In the case of hydrogen bonds, specify the number of bonds such that one horizontal line corresponds to one hydrogen bond. Label the 5’ and 3’ ends of your polynucleotide strands.
Br brown O orange B blue P pinkW white G green Y yellow R red
Structure of Genetic Material
DNA RNA
BIOLOGY ACTIVITY -Gene Mutations and Proteins
Objective: To demonstrate how gene mutations affect the production of proteins?
Procedure:
Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC.
2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below.
Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below.
If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below.
If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below.
Data:
mRNA from
Step 2
Protein Sequence from Step 3
Protein Sequence from Step…
Please ASAP. Thank you.
Regarding the double helix of DNA, which of the following is true?
a.
Guanine pairs up with cytosine with three hydrogen bonds
b.
Complementary strands of DNA are held together by covalent bonds
c.
The backbone consists of ribose sugars H-bonded to phosphate groups
d.
Uracil pairs up with adenine with two hydrogen bonds
Chapter 3 Solutions
Biology (MindTap Course List)
Ch. 3.1 - Describe the properties of carbon that make it the...Ch. 3.1 - Define the term isomer and distinguish among the...Ch. 3.1 - Identify the major functional groups present in...Ch. 3.1 - Explain the relationship between polymers and...Ch. 3.1 - What are some of the ways that the features of...Ch. 3.1 - Prob. 2CCh. 3.1 - Prob. 3CCh. 3.1 - Prob. 4CCh. 3.1 - Prob. 5CCh. 3.2 - Distinguish among monosaccharides, disaccharides,...
Ch. 3.2 - VISUALIZE Draw simple sketches comparing the...Ch. 3.3 - Distinguish among fats, phospholipids, and...Ch. 3.3 - Prob. 1CCh. 3.3 - Explain why the structure of phospholipids enables...Ch. 3.4 - Give an overall description of the structure and...Ch. 3.4 - Prob. 8LOCh. 3.4 - Distinguish among the four levels of organization...Ch. 3.4 - Prob. 1CCh. 3.4 - Prob. 2CCh. 3.5 - Describe the components of a nucleotide. Name some...Ch. 3.5 - VISUALIZE Sketch a pyrimidine nucleotide subunit...Ch. 3.6 - Compare the functions and chemical compositions of...Ch. 3.6 - How can you distinguish a pentose sugar from a...Ch. 3 - Prob. 1TYUCh. 3 - VISUALIZE The structures depicted are (a)...Ch. 3 - Prob. 3TYUCh. 3 - The synthetic process by which monomers are...Ch. 3 - A monosaccharide designated as an aldehyde sugar...Ch. 3 - Structural polysaccharides typically (a) have...Ch. 3 - Saturated fatty acids are so named because they...Ch. 3 - Fatty acids in phospholipids and triacylglycerols...Ch. 3 - Which of the following levels of protein structure...Ch. 3 - Which of the following associations between R...Ch. 3 - Each phosphodiester linkage in DNA or RNA includes...Ch. 3 - PREDICT Do any of the amino acid side groups shown...Ch. 3 - PREDICT Like oxygen, sulfur forms two covalent...Ch. 3 - Hydrogen bonds and van der Waals interactions are...Ch. 3 - EVOLUTION LINK In what ways are all species alike...Ch. 3 - EVOLUTION LINK The total number of possible amino...Ch. 3 - EVOLUTION LINK Each amino acid could potentially...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- VISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.arrow_forwardUsing Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.arrow_forwardQuick help Only cell biology Which process is described in the following paragraph? During DNA synthesis, before the enzyme adds the next nucleotide to a growing DNA strand, it checks whether the previously added nucleotide is correctly base-paired to the template strand. If so, the polymerase adds the next nucleotide; if not, the polymerase clips off the mispaired nucleotide and tries again. This is carried out by cleaving the phosphodiester backbone using the enzyme’s 3’-to-5’ exonuclease activity.arrow_forward
- Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.arrow_forwardChoose a pentapeptied composed of five different amino acids. List the five amino acids. Present the messenger RNA codons for the amino acids and the sequence of the nucleotids on the DNA that was originally coded for the pentapeptide.arrow_forwardBuild a 3D model of a DNA molecule:-3-dimensional built structure -Contain sugar-phosphate backbones (constructed as separate molecules) -Contain nitrogenous bases (paired clearly and correctly) -Have a minimum of 10 base-pairs (minimum of 10 “rungs” or “steps” on the ladder) with the correct number of hydrogen bonds illustrated between each of the base pairs. -Have the orientation labeled on each strand and make sure the two strands are antiparallel.arrow_forward
- Like DNA, RNA follows base-pairing rules. Experiment to find which RNA nucleotide on the right side of the Gizmo will successfully pair with the thymine at the top of the template strand of DNA. (NOTE: The DNA on the right side is the template strand.) Which RNA base bonded with the thymine?arrow_forwardWhich choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino Acidsarrow_forwardWrite the structure of DNA (5 statements at least) Give 4 differences between DNA and RNA If one strand of DNA has the following nucleotide sequence, then the complementary strand willhave:- A T A G G C T G C C C G –- - COMPLIMENTARY STRAND What are plasmids? What are sticky ends? What is the function of Ligase? DNA Gel electrophoresis is conducted on what principles? Write at least 3.arrow_forward
- RNA polymerase from E. coli (core enzyme alone) has all of the following properties except: a)requires all four ribonucleoside triphosphates and a DNA template. b)can extend an RNA chain and initiate a new chain. c)recognizes specific start signals in DNA. d)produces an RNA polymer that begins with a 5'-triphosphate. e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.arrow_forwardDuring gel electrophoresis, DNA molecules can easily be separated according to size because all DNA molecules have the same charge-to-mass ratio and the same shape (long rod). Would you expect RNA molecules to behave in the same manner as DNA during gel electrophoresis? Why or why not?arrow_forwardDNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license