Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU

Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Related questions

Q: What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG?

A: Transcription and translation are processes that a cell employs to create all of the proteins…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA…

A: Genes are the structural and functional units of heredity. They carry coded genetic information in…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

Q: Compare the process of Replication, Transcription, and Translation by describing the following…

A: In the molecular biology, the genetic information is encoded in the DNA. Central dogma consists of…

Q: What protein is key in the termination process of DNA replication in E. Coli?

A: In molecular biology, DNA replication is the biological process of producing two identical DNA…

Q: What is the complementary strand of TTGACAGTAAAA?

A: Deoxyribonucleic acid (DNA) consists of two polynucleotide chains which are held together by…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide…

Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…

A: The correct answer is C) A-A-A-A-A; nucleus .

Q: Why would translation not work if ribosomes could bind only one tRNA at a time?

A: According to the central dogma of the molecular theory, the information stored in the DNA is first…

Q: Suppose you are provided with a sequence of nucleotides. How would you determine if the sequence is…

A: DNA and RNA are the main components that carry genetic information from one generation to another…

Q: The sequence below shows a mRNA sequence derived from a template strand of a DNA molecule: DNA…

A: DNA undergoes replication to form 2 DNA molecules (one parental strand and one new strand) and then…

Q: For translation, identify two things that happen during each step - initiation, elongation and…

A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…

Q: If the DNA template strand was TACCTAGAT, what would the mRNA codons be?

A: This process is called transcription i.e synthesis of m RNA from DNA. The DNA strand that forms m…

Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: The process of translation involves three distinct phases: initiation, elongation, and termination.…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that…

A: Introduction: DNA is a hereditary material that transfers from one generation to another. It is a…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…

Q: Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding…

A: Exons and introns are nucleotide sequences within a gene. Exons are the coding sections of a gene…

Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…

Q: During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following…

A: Replication is a biochemical process by which the DNA is synthesized on itself. It is mode by which…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: Why do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?

A: DNA chip used in microarray

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA…

A: "Since you have asked multiple questions, we are eligible to answer only the first three parts.…

Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…

A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: If the DNA strand has nitrogenous base sequence ATTGCC, the mRNA will have?

A: The transcription is a process of conversion of DNA to mRNA using RNA polymerase enzymes which…

Q: Which of the following are stages of translation? Select all that apply. ---A tRNA binds to…

A: The translation is a process, in which tRNA (Transfer Ribonucleic acid), mRNA (messenger RNA),…

Q: When glycoproteins are synthesized in the cell, at what stage of the polymerization of the protein…

A: Proteins with covalently linked sugar residues are known as glycoproteins. Sugars' hydrophilic and…

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: Transcription is the process by which RNA is synthesized from DNA. The genetic material is…

Q: Describe the differences in translation initiation between prokaryotes and eukaryotes?

A: Translation in terms of biology refers to the process by which the RNA (ribonucleic acid)…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

Q: The MRNA produced when the following sense strand DNA sequence is transcribed is: 5'-…

A: The transcription unit is the segment of DNA that takes part in transcription. It is studied under…

Q: Arrange the following steps in correct sequence. Translation 1. Formation of the peptide bond 2.…

A: The nucleotide is the most fundamental component of nucleic acids. The polymers RNA and DNA are made…

Q: If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to…

A: During the process of transcription, the template strand or non-coding strand of DNA molecule gives…

Q: In eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA…

A: Eukaryotic cells are huge and sophisticated creatures having a nucleus encased within the nuclear…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Introduction : Transcription is the process in which a DNA sequence is transcribed into an RNA…

Q: Describe the critical role that complementary base-pairing plays in replication, transcription, and…

A: The nucleic acids have a property of complementary base-pairing. The nitrogenous base attached to…

Q: How many times would telomerase have to bind to a different site in the telomere to make a segment…

A: During the time of DNA copying, one of the strands is synthesizing continuously at the replication…

Q: A peptide has the sequence NH 2-phe-pro-lys-gly-phe-pro-COOH. Which of the following sequences in…

A: Correct answer :- 5' TTT-CCC-AAA-GGG-TTT-CCC ( option B is correct.)

Q: What is the meaning of translation in molecular biology?

A: The literal meaning of translation is conversion of data from one language to another. This is the…

Q: Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'

A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…

Q: Using the example above, transcribe the following DNA strand into mRNA and translate that strand…

A: During transcription, the enzyme RNA polymerase uses DNA as a template to produce a pre-mRNA…

Q: Which amino acid would be attached to a tRNA that read "GGU"?

A: Introduction : A codon is defined as a sequence of three nucleotides which together form a unit of…

Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Translation of the dna sequence AAGCTGGGA would result in:

A) a DNA strand with the base sequence TTCGACCCT

B) an mRNA strand with the sequence TTCGACCCT

C) a sequence of three amino acids linked by peptide bonds

D) an mRNA strand with the sequence UUGCACCCU

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?
The process of translation involves three distinct phases: initiation, elongation, and termination. Which of the following is an accurate statement of a molecular event that occurs during one of the phases? A. All phases of translation require the energy of ATP to fuel molecular processes. B. The first components to assemble in initiation are the large ribosomal subunit, mRNA, and the initiator tRNA molecule. C. A peptide bond forms between the new amino acid and the amino acid at the C-terminus of the growing polypeptide chain. D. Amino acids are added to the polypeptide chain that sits in the A site of the translation initiation complex.
Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′
What is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 '
If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’