1. Where would the RNA polymerase II bind this piece of DNA = region B 2. What DNA sequence would the general transcription factor TFIID recognize before binding? TATAAA 3. What region would provide cell type-specific expression? region E 4. What site would significantly increase gene expression = region A 5. What region or regions of this gene's coding sequence would not be expressed as amino acids = region %3D

1. Where would the RNA polymerase II bind this piece of DNA = region B 2. What DNA sequence would the general transcription factor TFIID recognize before binding? TATAAA 3. What region would provide cell type-specific expression? region E 4. What site would significantly increase gene expression = region A 5. What region or regions of this gene's coding sequence would not be expressed as amino acids = region %3D

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 21QP: Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to...

See similar textbooks

Similar questions

Given the following schematic for a gene and its associated regulatory regions, answer the following questions by placing the correct letter in the provided blanks please put in the correct letter for the questions What region would provide cell type-specific expression of genes? region What site would significantly increase gene expression rates? = region What region or regions of this gene’s coding sequence are expressed as amino acids = region
Explain using leucine zipper motifs as an example, how protein-protein interactions between transcription factors containing such motifs can generate diversity in transcriptional activation. Refer to the recognition of DNA elements in gene promoters to justify your answer. Assume transcription factor A binds to DNA element A’, transcription factor B binds to DNA element B’, and so forth.
Briefly name and explain five mechanisms by which transcription factors activate transcription, with specific reference to targets in the basal transcription complex
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?
If the binding activity was purified, suggest two experimental approaches that could be taken to verify that this factor is in fact a transcription factor? Explain.
Name the lambda promoters whose expression is regulated by the cro protein. For each promoter you named, is cro an activator or a repressor of transcription from that promoter?
You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind From the list given - choose all components that you think are part of a typical eukaryotic gene From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression
Using CREB and nuclear receptors as examples,compare and contrast the structural changes that takeplace when these transcription factors bind to their coactivators
Describe the basic models of transcription factor families, the two transcription factors each representing these models, and how they function molecularly by specifying some of their functions.
The binding of a small effector molecule, protein-protein interactions, and covalent modifications are three common ways to modulate the activities of transcription factors. Which of these three mechanisms are used by steroid receptors and by the CREB protein?
Select all of the processes that could be involved in a transcriptional repressor leading to decreased gene expression. a. chromatin remodelling complex responds to tail modification by removing nucleosomes . b. transcription factor binding attracts acetyltransferase enzymes . C. transcription factor binding attracts deacetylase enzymes . D. chromatin remodelling complex responds to tail modification by shifting nucleosomes to a denser grouping. E. DNase cuts the exposed DNA to prevent transcription initiation F. RNA polymerase is unable to recognize the promoter because of the dense chromatin configuration
In response to potentially toxic substances (e.g., high levels of iron), eukaryotic cells often use translational or posttranslational regulatory mechanisms to prevent cell death, rather than using transcriptional regulatory mechanisms. Explain why.