1.3 Considering the atomic structure of DNA shown below, what are the features of the molecule that will be seen most clearly in an x-ray scattering experiment? Hydrogen • Oxygen • Nitrogen Carbon Phosphorus Pyrimidines Purines Minor groove Major groove

1.3 Considering the atomic structure of DNA shown below, what are the features of the molecule that will be seen most clearly in an x-ray scattering experiment? Hydrogen • Oxygen • Nitrogen Carbon Phosphorus Pyrimidines Purines Minor groove Major groove

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 16QP: A beginning genetics student is attempting to complete an assignment to draw a base pair from a DNA...

See similar textbooks

Related questions

Q: If the ecological footprint per person of a country or theworld is larger than its biological capaci...

A: As per the data that is given, those countries that are having a higher ecological footprint per hea...

Q: This is an example of a female wing. ARAN MORE VIDEOS gadwall shoveler pintail wigeon

A: * gadwall is common in dabbling duck. *Wingspan is 6 to 56 cm long * The wing shows light grey wit...

Q: required question .Q-32 Evaluate the essential safety precautions required when chlorophyll is extra...

A: Introduction In this question we have to Evaluate the essential safety precautions required when chl...

Q: Covid-19 may be regarded as a hazardous biological agent. why? (brief summary)

A: The COVID-19 is a contagious disease, that means spread from human to human. It is caused by a coron...

Q: Zoey is 25 years old. She does a two stage treadmill test to estimate her VO2max. For stage one, she...

A: The highest quantity of oxygen a person can use during intensive or maximal exertion is referred to ...

Q: Differentiate the following according to their anatomical characteristics. Give at least five differ...

A: AGNATHA:- Agnatha are the Jawless vertebrates, in the phylum Chordata, subphylum vertebrata. Example...

Q: Summarize the major outcomes of glycolysis. Include what molecule it started with, what molecules ar...

A: Glycolysis, or the aerobic catabolic breakdown of glucose, produces energy in the form of ATP, NADH,...

Q: Below is the linkage map for genes y, sh and c that are in cis arrangement. Interference is 0.4 and ...

A: Linkage is a phenomenon which occurs when two genes are present in the same chromosomes. Some animal...

Q: A mutation creates a STOP codon where one was not before. Which of the following could NOT be the mu...

A: Stop codons are triplets of nucleotides found in messenger RNA (mRNA) that signify the end of protei...

Q: Which of the following is the best description of what happens in capillaries? A. Capillaries are s...

Q: Our Campbell Biology textbook is literature. O primary scientific O primary popular O secondary sciê...

A: Solution : Campbell Biology, better known as the bible of biology, is a famous book used around the ...

Q: Name 3 ways on how parasite diseases can be transmitted to man

A: Parasite is an organism which lives on or in another organism, which are called as host cells. paras...

Q: Q -9 Outline how the electron microscope has increased our knowledge of cell structure.

A: Electron microscopy is the technique used for obtaining high resolution images of biological and non...

Q: Not graded, What answer choice?

A: A eukaryotic cell is much more sophisticated than a bacterial cell, which has only cytoplasm and onl...

Q: A. Directions: Examine the following statements, then decide which evidence of evolution does it sup...

A: Evolution is the process by which a group of organisms undergoes cumulative hereditary change over t...

Q: You crossed tall pea plants to another tall pea plants. You collected all the seeds and planted them...

A: Mendel chose pea plants to study genetics because they had easily identifiable characteristics. Pea ...

Q: Q-6 Explain the significance to organisms (plants and animals) of water as a coolant and transport m...

A: Answer

Q: what will happen to the egg when it was soaked in warm water

Q: Q-6 Explain the significance to organisms (plants and animals) of water as a coolant and transport m...

A: Water Water is the molecule made up of two hydrogen and one oxygen atom (H2O).

Q: Gene Linkage, Crossing Over, and Mapping Genotype of Diploids Phenotype Crossover Type Frequency 1. ...

Q: What types of organisms do Alcohol fermentation? Summarize this process.

A: Alcoholic fermentation (also known as ethanol fermentation) is a biological process that converts su...

Q: xplain why stool specimen should not be contaminated with urine and wate

Q: Aside from H&E, what other staining methods are applicable in Golgi apparatus, mitochondria, and nuc...

A: Answer :- Subsequent to trying different things with presenting cells to gold and mercury, Golgi uti...

Q: What type of evolutionary mechanisms occurs in Antibiotic Resistance and how this affect the populat...

A: Introduction:- The ability of a bacterium to tolerate the effects of an antibiotic is known as antib...

Q: Grylloblattodea is Paleoptera undergoes a pupal stage lives in high altitude or ice caves is the Can...

A: Introduction :- Grylloblattodea is an insect belongs to an order polyneoptera which is closely relat...

Q: What are the ways that can encourage other people to engage in physical activities?

A: Introduction:- Physical activity has numerous advantages. Being physically active entails moving suf...

Q: What are some of the barriers to healthcare for people of color in the US?

A: Answer

Q: Modern fishes The Sample format (MindMeister) for creating a mind map is attached below.

A: ANSWER :: STEP 1 OF 2 :- Vertebrates (also called Craniata) are all creatures that belong to the Ver...

Q: How do natural selection, environment, and genetics influence animal behavior?

A: Natural selection It is essential to understand natural selection because it is a critical component...

Q: Which of the following statements concerning axonal transport is FALSE O A) The polarity of microtub...

A: Axonal transport is considered exoplasmic flow or exoplasmic transport. This mechanism helps in the ...

Q: The S (spike) glycoprotein of coronaviruses can engage receptors by the N-terminal domain, the C-ter...

A: According to the question, the newly discovered coronavirus has a S protein with an N-terminal domai...

Q: Enumerate 5 lab tests/procedures done to obtain/identify Lymphocytes. Then briefly discuss one

A: Answer

Q: Last Valentine's day, an 18-year old girl received a bouquet of flowers from the boy that she likes....

Q: Until the Krebs cycle, aerobic respiration can be described without mentioning oxygen, the chemical ...

A: From the above question given Krebs cycle, aerobic respiration can be described without mentioning ...

Q: The life span of white blood cells is Select one: a. none of above b. months to even years C. minute...

A: The components of the blood are plasma and formed elements. The formed elements include RBC, WBC, an...

Q: Class the protein types in human body

A: In our body there are hundreds and thousands of proteins are present however these proteins characte...

Q: How often do forensic anthropologists misidentify race, according to Goodman?

A: Forensic anthropologists are called upon to gather information from the bones and their recovery con...

Q: Explain how the system of pores operate in a typical sponge.

A: Sponges are unusual animals in that they lack definite organs to carry out their various functions. ...

Q: Endocytosed enveloped viruses leave endosomal compartments at some point during endosome maturation ...

A: Answer :- Enveloped viruses leave their host cell by maturing from a phone layer and consequently sp...

Q: How can i handle the side effects of hot flashes, nausea, and vomiting from my medication Tamoxifen

A: Tamoxifen is a hormonal therapy use to treat breast cancer. Tamoxifen is an antagonist of estrogen r...

Q: Transcription factors such as myoD control gene expression in which of the following ways? Group of...

A: MyoD, also known as myoblast determination protein, is a protein found in mammals that regulates mus...

Q: What are the types of evidence and procedures that can be used to establish evolutionary relationshi...

A: Evolution can be defined as the change in something or change of something (can be habit, behaviour,...

Q: Compare and contrast the following processes in plants and animals in terms of their reproduction, d...

A: Plants and animal are quite similar at cellular level however very different at organ system level. ...

Q: The light photomicrograph (see image below) shows a single type of bacterial cell treated with Giems...

A: Magnification = length of image ÷ actual length of organism

Q: What are thr primary risk factors for T2D and CVD that you can change through your lifestyle choices...

A: Introduction T2D or type 2 diabetes is a condition where body does not produce sufficient insulin o...

Q: Question 3 In a population with high resource value relative to cost (V =2*C), which strategy is con...

A: Introduction: The populations showing low resource value (V< C) relative to cost (C), the hawks a...

Q: what may happen to the components of the cell membrane if soaked in water

A: Water is a hypotonic solution, which means it has a low concentration of dissolved solutes in it (el...

Q: Define malnutrition and identify a specific disease that can result from it. Perform library researc...

A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...

Q: I am doing my microbiology homework and I need help with these questions: 1) List the structures A...

A: Bacteria are ubiquitous, mostly free-living organisms often consisting of one biological cell. They...

Q: how does ethanol affect cell transport process?

A: The cell membrane is made of a phospholipid bilayer with proteins and cholesterol molecules interspe...

Concept explainers

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.

Question

1.3

1.3 Considering the atomic structure of DNA shown below, what are the features of the
molecule that will be seen most clearly in an x-ray scattering experiment?
Hydrogen
• Oxygen
• Nitrogen
Carbon
Phosphorus
Pyrimidines Purines
Minor groove
Major groove

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The length of a DNA molecule is 680 nm when the DNA molecule is in B-conformation. How many helical turns does the DNA molecule have if the DNA molecule is in A-conformation?
Why is the separation possible given that all the DNAs (of close circular DNA, open circular DNA and super coiled DNA ) have the same molecular weight?
A strand of nucleic acid is defined by its sequence of nucleotides: A, C, T, and G. How many different sequences are possible for a nucleic acid that is 200 nucleotides long? How does that number compare to the estimated number of atoms in the universe, which is approximately 1080?
A primitive eukaryote was discovered that displayed a unique nucleic acid as its genetic material. Analysis provided the following information: (a) The general X-ray diffraction pattern is similar to that of DNA, but with somewhat different dimensions and more irregularity. (b) A major hyperchromic shift is evident upon heating and monitoring UV absorption at 260 nm. (c) Base-composition analysis reveals four bases in the following proportions: Adenine = 8% Guanine = 37% Xanthine = 37% Hypoxanthine = 18% (d) About 75 percent of the sugars are deoxyribose, while 25 percent are ribose. Postulate a model for the structure of this molecule that is consistent with the foregoing observations.
1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions proposed by Watson and Crick. 2. Considering the number of base pairs, compute for the actual length of the given DNA strand in micrometer. (1m = 10,000Ao) 3' C G A C T A C 5' 5' G C T G A T G 3'
2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).
At 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous base, deoxyribose).
A beginning genetics student is attempting to complete an assignment to draw a base pair from a DNA molecule. The drawing is incomplete, and the student does not know how to finish. He asks for your advice. The assignment sheet shows that the drawing is to contain three hydrogen bonds, a purine, and a pyrimidine. From your knowledge of the pairing rules and the number of hydrogen bonds in A/T and G/C base pairs, what base pair do you help the student draw?
Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA molecule allowthis distinctive structure to form?
5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the previous question, starting at the second base.
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
What is the axial ratio (length:diameter) of a DNA molecule 20 μm long?