1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions proposed by Watson and Crick. 2. Considering the number of base pairs, compute for the actual length of the given DNA strand in micrometer. (1m = 10,000Ao) 3' C G A C T A C 5' 5' G C T G A T G 3'

1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions proposed by Watson and Crick. 2. Considering the number of base pairs, compute for the actual length of the given DNA strand in micrometer. (1m = 10,000Ao) 3' C G A C T A C 5' 5' G C T G A T G 3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

1. Describe what you saw on the boundary between the fruit mixture and the alcohol. 2. Based from our previous lessons, draw the a.) chemical and b.) double-helix structure of DNA. Label the DNA components. 3. Why do you think there is a need to mash and strain the fruit to isolate the DNA? 5. Identify the complementary nucleotides for the DNA chain below: 5’ GCATTTAAATTGGGGCGCGTAATGCCGGGGGATTACCCAATATGTAC 3
Which of the following statements DOES NOT apply to the Watson and Crick model of DNA? a. The two strands of the DNA helix are anti-parallel. b. The distance between the strands of the helix is 20 angstroms (A). c. The framework of the helix consists of sugar-phosphate units of the nucleotides. d. The two strands of the helix are held together by covalent bonds. e. The purines are attracted to the pyrimidines. ...Explain your answer.
One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?
When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′
The melting temperature Tm of DNA can be predicted by calculation without actually measuring it. Calculate the Tm of the DNA double strand shown in (1) to (3), and discuss the results. The numbers in parentheses indicate the degree of polymerization of nucleotides.(1) A(10) + T(10), (2) A(15) + T(15), (3) G(10) + C(10)
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your answers, show how you came up to each result?(a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in micrometer?
Moira, a biochemistry major, wanted to explore the shapes a single-stranded DNA molecule can take. She sketched the two shapes below. Her professor was impressed with Moira’s imagination and artistic ability, but she informed Moira that only one of her sketches was feasible. In the sketches, the lines indicate complementary base pairing. (d) Would a new double-stranded molecule assume the shape similar to one in the drawing? (e) Why or why not?
1) How many bases are found (on one of the strands) in a single twist of a DNA helix: a) 3.4 b) 10 c) 2 d) 0.34 2)Which of the following is a correct representation of a segment of DNA: a) I b) I and III c) IV and V d) V and I 3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3'Translated, the corresponding protein contains how many amino acids: a) 6 b) 7 c) 8 d) 13
1) a) Sketch an A-form helix and a B-form helix, highlighting the differences between them. Indicate the bases and backbone as lines. Label the major and minor grooves. 2) Sketch a ribose in the pucker that is expected in RNA. 3) Sketch a 2’ deoxyribose in the pucker that is expected in DNA. 4) Draw a GCG triplet (GC Watson-Crick), with perfect geometry. Draw the bases only, with dR’s at the N-9 positions of the purines (Gs) and at the N1 positions of the pyrimidine (C)
1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
1. Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’ A. How many Phosphodiester bonds are required to form this segment of double-stranded DNA? B. How many hydrogen bonds are present in this DNA segment?
2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).