Why is the separation possible given that all the DNAs (of close circular DNA, open circular DNA and super coiled DNA ) have the same molecular weight?

Q: In a DNA Double helix ,why doesn't an A or T form two hydrogen bonds(out of the three possible) with…

A: DNA is a double helix structure that consists of four nitrogenous bases names Adenine (A), Thymidine…

Q: why can we not describe the “average” behavior of a DNA molecule? Why is it improbable that proteins…

A: DNA is the molecular name for the molecule in all living things that conveys genetic instructions.…

Q: What is the complete base composition of a double-stranded eukaryotic DNA that contains 22% guanine?…

A: Chromosomes in a eukaryotic cell are composed of DNA and protein. DNA in eukaryotes is double…

Q: If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of…

A: DNA : Deoxyribonucleic acid is a double stranded molecule in which two strands are anti parallel and…

Q: Draw roughly the comparative electrophoretic mobilities of close circular DNA, open circular DNA and…

A: Gel electrophoresis is the technique of separation of molecules on the basis of their size and…

Q: Which of the following is the correct way that heterocyclic bases are paired between two polypeptide…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…

Q: In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of three possible) with G…

A: The DNA (deoxyribonucleic acid) is made up of nucleotide bases that are made up of nitrogenous bases…

Q: What is the axial ratio (length:diameter) of a DNA molecule 20 μm long?

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: How many of each base is found in the complete double-stranded molecule?

A: The concept is based on Chargaff's rule. It is given by Erwin Chargaff to calculate the amount of A,…

Q: Describe the structure of DNA.   The two strands of DNA are antiparallel. What does the term…

A: Describe the structure of DNA. DNA is created from molecules known as nucleotides. every nucleotide…

Q: The human genome contains 3 billion nucleotides arranged in a vast array of sequences. What is the…

A: Genes are the hereditary unit of an organism. The DNA (deoxyribonucleic acid) forms the genes. DNA…

Q: How would the appearance of your DNA gel change if a 0.1% agarose gel slab was used? What about a 7%…

A: If 0.1% agarose gel slab was used then DNA cannot be seen clearly, it will break.Low…

Q: Chargaff’s rule states that the amount of _______ in DNA is always roughly equal to the amount of…

A: Introduction :- The Chargaff rule of base pairing and how the two strands of DNA are bound together…

Q: What are the four nitrogenous bases and which bases pair with one another in a double-stranded…

A: DNA is a double helical structure that contains genes. Genes are the functional unit of heredity in…

Q: An analysis of the genetic material of an unknown sample showed that it contains 1996 adenine bases,…

A: Friedrich Miescher discovered nucleic acids from the nuclei of pus cells and coined the term…

Q: iven the structures of the nitrogenous bases below, draw the structure of a part of DNA with the…

A: The hereditary substance present in the cell is known as the genetic material. DNA acts as the…

Q: What is the complete base composition of a double- stranded eukaryotic DNA that contains 22%…

A: the 4 nucleotides that make up the DNA show a unique property of complementary base pairing wherein…

Q: hy is the separation possible

A: DNA analysis is the term given to the clarification of genetic sequences and can be used for a vast…

Q: Ъ. Why are some of the bands of DNA fragments thicker (brighter) than the others?

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: What are the exceptions to the general rule that DNA is the genetic material in all organisms? What…

A: The exception is that RNA is the genetic material in some organisms. Many viruses have been shown to…

Q: What is the total number of hydrogen bonds that exist between the DNA strand 5’-TTCAGAG-3’ and its…

A: Adenine and guanine are the purine bases which occur in the nucleic acids. And thymine, cytosine,…

Q: What distance separates base-pairs in the Watson-Crick model of DNA? O 2.3Å O 3.4Å O 4.5Å O 5.6Å

A: DNA is a double helix structure that is made up of two long strands that are coiled around a central…

Q: Which type of nucleic acid would have the sequence "ACCGAUUG"?

A: There are two types of nucleic acids seen in a cell, Deoxyribose nucleic acid or DNA, and Ribose…

Q: Draw roughly the comparative electrophoretic mobilities of close circular DNA, open circular DNA and…

A: Gel electrophoresis is the technique of separation of molecules on the basis of their size and…

Q: Why is separation possible given that all  open circular DNA and super coiled DNA  have the same…

A: Gel electrophoresis is a technique through which DNA fragments of different sizes can be separated.…

Q: If the amino acid sequences of monkeys and humans in the protein of two organisms are similar, why…

A: Amino acids  Amino Acids are known as building blocks of proteins. There are many different kind of…

Q: One strand of a double-helical DNA has the sequence (5′)GCGCAATATTTCTCAAAATATTGCGC(3′). Write the…

A: The complementary strand is (5')GCGCAATATTTTGAGAAATATTGCGC(3') (sequence of a single strand is…

Q: What properties of DNA make it especially well suited to serve as the genetic material?

A: DNA is a type of nucleic acid. It is a polymer of nucleotide. Initially RNA is believed to be the…

Q: Draw a DNA structure that includes at least two criss crosses There must be 5 nucleotide pairs above…

A: The structure of DNA is a double stranded helical structure which is coiled and have two parallel…

Q: Given the DNA sequence; 3’-GCTACGTCGC-5’ 5’-CGATGCAGCG-3’ What is the total number of hydrogen…

A: Hydrogen bonds: The electrostatic force of attraction which involves Hydrogen atom.

Q: Which of the following is true about the structure of DNA as proposed by Watson and Crick (B-form…

A: Introduction:  Nucleic acids are large complex biomolecules that store hereditary information…

Q: How many different 8-mer sequences of DNA are there?

A: Oligonucleotides are short DNA or RNA molecules. They are characterized by the sequence of…

Q: Why does DNA with a high A-T content have a lower melting temperature, Tm, than DNA with a high G-C…

A: Deoxyribonucleic acid(DNA) is a molecule that contains two polynucleotide chains that coil around…

Q: hat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’?…

A: introduction

Q: When Chargaff was performing his experiments, the tetranucleotide hypothesis, which stated that DNA…

A: Chargaff principle states that the DNA from any organism should have 1:1 stoichiometric ratio of…

Q: What type of DNA helix spirals to the left and the backbone takes on a zigzag shape?

A: Deoxyribonucleic acid (DNA) is the genetic material of the majority of the organisms.

Q: The most common elements in living organisms are carbon, hydrogen, oxygen, nitrogen, phosphorus, and…

A: The macromolecules essential to life are formed using these common elements such as hydrogen,…

Q: What components make up a single nucleotide of DNA? Select all that apply.   A. Ribose sugar   B.…

A: The principal biomolecules that carry genetic instructions in all organisms are called nucleic…

Q: A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of…

A: DNA (deoxyribonucleic acid) is a double-stranded molecule and base pairing between two strands is…

Q: For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below…

A: Given: a sequence of amino acids, serine-valine-lysine-leucine

Q: 1.3 Considering the atomic structure of DNA shown below, what are the features of the molecule that…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Which of the following DNA strands below is expected to have the highest melting temperature?

A: DNA is the genetic material in living beings. It can be seen both in prokaryotes and eukaryotes. The…

Q: A strand of nucleic acid is defined by its sequence of nucleotides: A, C, T, and G. How many…

A: Nucleic acids are large biomolecules or biopolymers which is vital for each known form of life. The…

Q: What does it mean for DNA to be antiparallel? -The two strands of polynucleotides are in opposite…

A: DNA is the hereditary material found in an organism.

Q: If the first strand of DNA is AGCTGCAAT, what would be the nitrogen base sequence of the second…

A: DNA is a biomolecule which contains two strands. Each strand has a backbone composed deoxyribose…

Q: In a segment of DNA consisting of 1000 nitrogen bases, 28% of which are thymine, how many bases are…

A: The majority of the cells have DNA as the genetic material. DNA is transmitted from the parents to…

Q: In 1950 Erwin Chargaff published a scientific paper showing the percentages of the nitrogen bases…

A: Chargaff had shown that of the four types of monomers present in a DNA molecule out of which two…

Q: What are the monomers that makeup a nucleic acid and what are the monomers composed of? What type of…

A: Biomolecules are organic compounds found in living organisms. All living organism will have these…

Q: Assume that an error is made: adenine and guanine are matched as base pairs.  What would be the…

A:

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.