What fold-difference exists between the KD of the first and the KD of the second binding event?
Q: Why is it 2n-2?
A: A molecule is called chiral molecules if it cannot be superposed on its mirror image by any of A…
Q: How does placing the solution in a boiling bath terminate the hydrolysis reaction mediated by…
A: The protein enzyme α-amylase is a key player in the hydrolysis reaction of starch molecules.
Q: TRUE OR FALSE 1. Both strands of a daughter DNA molecule are formed through the linking of…
A: The nucleic acid polymer has nucleotide as its monomeric unit. Nucleotides are essential in the…
Q: Lipid anchor is myristic acid and linked to a glycine…
A: Introduction: Lipids are a heterogeneous class of compounds that are insoluble in water and…
Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. C…
A: If we represent the nitrogen base as a triangle, there are going to be three edges: Hoogstein Edge:…
Q: ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize your…
A: Hydrolization of lactose gives the galactose and glucose moieties. Galactose are converted to…
Q: Please answer all the problems below with complete solution thank you so much I will rate your…
A: Glucose is the main substrate for carrying out cellular metabolism in the body, which is derived…
Q: A1 Calculate the ATP yield for the complete oxidation of oleate.
A: Oleate or Oleic acid is a monounsaturated fatty acid with the number of the carbon atoms equal to…
Q: Which of the following best describe protein digestion? . Protein digestion is a hydrolytic process…
A: Introduction: Proteins are the most abundant organic compounds in the living system. It constitutes…
Q: Cancer stem cells (CSCs) are cancer cells (found within tumors or hematological cancers) that…
A: Cancer stem cells like normal stem possess the ability of self renewal with one problem: the cell…
Q: Please answer fast Explain how you would go about developing new ribozymes capable of targeting new…
A: Ribozymes are the ones that arefound to be catalytically active RNA molecules. Here, RNA is…
Q: Bile acids are detergents made by the liver O True O False
A: Bile acids is the product secreted by liver by found in bile juice. Bile juice is stored in gall…
Q: 1.Discuss the Biochemical Tests for Lipids.
A: Lipids are biomolecules composed of fatty acids that are esterified to an alcohol. The biochemical…
Q: Osmosis is water movement across a semipermeable membrane. Which of the following is true about…
A: Osmosis is the type of diffusion that involves the passive movement of water through the…
Q: Briefly explain why allosteric inhibition is an example of negative heterotropic cooperativity and…
A: Heterotropic interactions observed in which the substrate binds to the enzyme at only one site and a…
Q: Do you think globalization affects the environment? Why or why not? Support your answer with…
A: Globalization is a process in which people of different countries or continents are interacting with…
Q: Amount (in μmol) 120 100 80 60 40 20 0 0 50 100 150 200 Time (s) 250 300 350
A: Salivary amylase is the Enzyme that acts on starch to break them into glucose units. Starch---->…
Q: 4. trans 18:2(49,12) 18:2;9,12 w6,9 5. cis 18:3(46,9,12) 18:3;6,9,12 w6,9,12
A: Trans Fatty acids have hydrogen atoms on opposite sides attached to the double bonded carbon atom .…
Q: 3 from left to right. The table below shows which mRNA codons code for each type of amino acid.…
A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Use the following peptides to answer the questions below: (They are in the image). Which peptide…
A: Amino acids differ in their R group, which determines their specific physicochemical…
Q: 1.0 0 0.5 0 5 Ligand A Ligand B 10 15 20 25 Ligand Ligand D 40 45 50 55 60 30 35 [Ligand] (MM)
A: Kd is dissociation constant which is ligand concentration at half of saturation or at 0.5 theta…
Q: With glycogen storage disease type V, the enzyme ______________ is defective or absent. a.…
A: Glycogen is the storage form of glucose in the body. The excess glucose molecules present in the…
Q: Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 Residue Number 2…
A: Hydrophobicity is defined as the tendency of non-polar molecules to form aggregates to reduce their…
Q: 1. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: In beta oxidation of saturated fatty acid, First step produces FADH2 catalyzed by Acyl CoA…
Q: Nutrition Facts 8 servings per container Serving size 2/3 cup (55g) Amount per serving Calories 230…
A: total fat value is 6 gram SATURATED FAT These are kinds fats which produces the high levels of…
Q: eals and whales have flippers and flukes that have no blubber and are very poorly insulated. How is…
A: Introduction: Thermal conductivity is the transfer of heat from one part of a body to another when…
Q: Lipid absorption involves hydrolysis of dietary fat in the lumen of the intestine followed by the…
A: Lipid absorption involves lipid uptake across the BBM ( brush border membrane) into the enterocyte,…
Q: 1) under intracellular conditions, answer : If G3P-DH is inhibited by Iodoacetic acid, which…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: A-DNA has a helix diameter of 25.5 Angstrom, a pitch per turn of 25.3 Angstrom, and a rise per base…
A: The A-DNA, B-DNA and Z-DNA are the commonly occurring structural conformations of DNA. The most…
Q: Kindly draw the structure of the lipids present in pig's brain with explanation.
A: Lipids found in pig's brain are typically MUFA, PUFA, SFA. The largest amount found is Stearic acid…
Q: Place the steps in the propagation of nerve impulses in the correct order.
A: Introduction: Nerve impulse is also called as "ACTION POTENTIAL". Action potential can be defined…
Q: Draw a standard workflow on plant metabolite profiling using GC-MS.
A: GC- MS stands for Gas chromatography Mass spectrometry. GC-MS is used for drug development ,…
Q: Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms)…
A: We are given the tertiary structure of a protein (enzyme). Here; the grey spheres indicate carbon…
Q: The steroid nandrolone, which is found naturally in horses, is administered to racing horses to aid…
A: Nandrolone is a steroid that is both anabolic and androgenic. It is formed from an estrane's…
Q: Consider fatty acids from the hydrolysis of the given TAG in a liver cell where amino acid and…
A: Fatty acid oxidation is the process in which long chain fatty acids are converted into acetyl-CoA.…
Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA…
A: Central dogma includes three main processes Replication, Transcription, and Translation.…
Q: Regulation of fatty acid metabolism is shown by the following strategies. Which statement is NOT…
A: Fatty acids are important component of the body, they serve as energy reserves of the body and help…
Q: explain the chemical reaction that occurs water molecules dissociate and reform. why is these…
A: Water is an essential molecule of life. Water is made up of two atoms of hydrogen along with one…
Q: 1. Where many select ▾ processes take place in the cell? select 2. Cell control center select 3. The…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Which of the following is NOT a regulatory mechanism for catabolism and anabolism? Phosphorylation…
A: Metabolism is a series of interconnected chemical reactions occurring within a cell. Metabolic…
Q: please show DETAILED mechanism and I will upvote: biotin carboxylase Ö- `NH O-C-OH + ATP bicarbonate…
A: Biotin, also called vitamin B7 is a water soluble vitamin. It is involved in a wide range of…
Q: Which abbreviation is this following peptide? GKH QGR HK GHK GHL
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Cancer stem cells (CSCs) are cancer cells (found within tumors or hematological cancers) that…
A: Regular stem cells like hematopoietic stem cell that give birth to the entire blood cell lineages,…
Q: The various forms of vitamin K Function as cofactors for enzymes with a key role in blood…
A: Vitamin K is a fat soluble vitamin. This vitamin was originally identified for its role in the…
Q: Among other effects, insulin is a positive modulator of the enzyme glucokinase in liver cells. If…
A: Insulin is a polypeptide hormone, which is produced by the β cells of the islets of Langerhans in…
Q: Please state if the statements are true or false. 1. A pyranose is a sugar in Haworth projection…
A: The answer is provided below.
Q: Reducing power for the synthesis of fatty acids is produced in which reactions? conversion of…
A: The fatty acid synthesis starts from acetyl Co-A which is an intermediate of the TCA cycle. The…
Q: Y [S] Fig. 12.2 Graph of Y against [S], at fixed protein concentration, where the binding shows…
A: Allosteric regulation is a mode of regulation of an enzyme or other protein. Allosteric activators…
Q: What would happen if you increased the concentration of the enzyme twofold? a) Vmax would also…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: The three-dimensional conformation of a protein may be strongly influenced by amino acid residues…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
![10
8
6
2
4
2
0
-2
-4
-6
-6
-2 0
2
4
8 10
log [L] (nM)
What fold-difference exists between the KD of the first and the KD of the second binding event?
6
10,000,000,000
1,000,000
10
4
6](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F572821e0-12d8-44f1-88bb-7fc88dda2af7%2F3594a8e7-780d-4c5f-a961-71f053730f75%2Fj8hw9bg_processed.png&w=3840&q=75)
Step by step
Solved in 2 steps with 1 images
- What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’Given a primer sequence 3’- CTGGGAAACATTCTGGAT - 5’, compute for the melting temperature of this 18-mer.For the following sequence, what is the approximate annealing temperature? 5'-AGCTACGATCAGGTCA-3'
- How many hemoglobin molecules are there in an average red cell? Assume that the molecular weight of the human hemoglobin tetramer is 65 kDa.What is the molecular weight of the Botulinum neurotoxin, a protein that contains 1350 amino acids? Assume an average distribution of amino acidsGiven a tripeptide Cys-His-Lys, Cys: Pk1 = 1.71; Pk2 = 10.78; PkR = 8.33 His: Pk1 = 1.82; Pk2 = 9.17; PkR = 6.0 Lys: Pk1 = 2.18; Pk2 = 8.95; PkR = 10.53 draw the protonic equilibria for the tripeptide what is the IpH?
- Dihedral angles of Phe165 of 4KW4 betasheet values are consistent with what is expected from the Ramachandran Plot?If the molecule can inhibit toxic effects at 0.5mM against gastric carcinoma cells, does it mean that the dimer of this nucleoside analogue will exhibit an IC50 of about 0.25mM?Which form of lysine in Problem 18.56 is the zwitterion? What is the pI for the zwitterion?
