Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms) of helix denoted as H2. b) Name the post-translational modification (PTM) the enzyme has underwent. c) Name chemical reagent to undo this PTM and number of equivalents of reagent needed.

Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms) of helix denoted as H2. b) Name the post-translational modification (PTM) the enzyme has underwent. c) Name chemical reagent to undo this PTM and number of equivalents of reagent needed.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2CT

See similar textbooks

Related questions

Q: Suggest and briefly describe an experimental design on testing the effect of enzyme trypsin on the…

A: Trypsin is an enzyme that is responsible for the breakdown or digestion of a protein. It is a serine…

Q: Branching decreases the solubility of glycogen. True False b. The branching enzyme forms the…

Q: Please state if the statements are true or false. 1. An l-sugar is a sugar where the -OH group at…

A: Sugars are also called carbohydrates. Carbohydrates are composed of carbon, hydrogen, and oxygen in…

Q: KM is determined by measuring the reaction velocity of two enzymes (X and Y) at different…

A: Enzymes are usually protein molecules which catalyzes a biochemical reaction by decreasing its…

Q: Please state if the statements are true or false. 1. An l-sugar is a sugar where the -OH in the…

A: Sugar is also called a carbohydrate. Carbohydrates are composed of carbon, hydrogen, and oxygen in…

Q: 1. How are organic molecules related to all living things?Explain. 2. Draw an Illustration showing…

A: One or more cells make up every living thing. Living things react to their surroundings and stimuli.…

Q: An enzyme catalyzes a reaction with a Km of 7.50 mM and a Vmax of 4.15 mMs. Calculate the reaction…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Which of the following is NOT a regulatory mechanism for catabolism and anabolism? Phosphorylation…

A: Metabolism is a series of interconnected chemical reactions occurring within a cell. Metabolic…

Q: At which pH would the structure shown be predominate? H₂N-CH- - H OpH 1 pH 3 pH 8 pH 11 0 0

A: Glycine has the simplest structure among all the amino acids. This side chain of amino acid has most…

Q: How does placing the solution in a boiling bath terminate the hydrolysis reaction mediated by…

A: The protein enzyme α-amylase is a key player in the hydrolysis reaction of starch molecules.

Q: Regulation of fatty acid metabolism is shown by the following strategies. Which statement is NOT…

A: Fatty acids are important component of the body, they serve as energy reserves of the body and help…

Q: a. Water is not a very good electron donor and requires solar energy to transfer electrons. True…

A: Photosynthesis is the conversion of light energy by phototrophs into chemical energy, which is then…

Q: Please state if the statements are true or false. 1. Erythrulose is a ketopentose 2. The conversion…

A: Erythrulose is a ketose Sugar with keto Functional group. It is mainly used in skin care products.…

Q: What TYPE of inhibition is observed in the following plot: 1/v₂ Intersect at Y axis 1/Km Competitive…

A: Enzymes can be inhibited , when the substrate and inhibitor compete for the binding to the same…

Q: Which of the following statements is TRUE about fatty acid activation before ß-oxidation? O The…

A: β-oxidation is the process of breakdown of fatty acids, in order to release energy during the…

Q: Match the lipoprotein or reaction based on the lipid transport pathway shown: DIETARY FAT AND…

A: Matching of the lipoprotein or reaction based on lipoprotein transport pathway as follows:

Q: The successful sequencing of the human genome The human genome holds an extraordinary amount of…

A: The Human Genome project or HGP is a huge project which was aimed to map and sequence the entire…

Q: Describe how enzymes are regulated (activated and inhibited)

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: Label the x axis in each graph below with the appropriate factor (possible factors: temperature, pH,…

A: Introduction: Enzymes are proteins that function as biological catalysts to accelerate the rate of…

Q: Which of the following statement(s) is/are TRUE about oleic acid? I. It has a lower melting point…

A: The double bond at C-9 exhibits Z (cis) stereochemistry, making oleic acid an octadec-9-enoic acid.…

Q: Discuss briefly but concisely the importance of the following metabolic pathway. E. Glycogenolysis…

A: These are the different pathways for carbohydrate metabolism. Glycogenolysis is the pathway for…

Q: Consider the complete oxidation of one mole of simple TAG containing lignoceric acid residues…

A: During the digestion of a triglyceride the fatty acids that are released are broken down in a series…

Q: Identify (1) the group where the lipid belongs, and (2) determine whether the lipid is saponifiable…

A: Lipids are the biomolecules that are nonpolar in nature. These can be simple lipids i.e. derived…

Q: D arrangement of localized regions of proteins A. PRIMARY B. SECONDARY

A: The three-dimensional arrangements of atoms in an amino acid chain, that folded up into specific…

Q: was diagnosed with osteoporosis («porous bones»). Osteoporosis is a common cause of fractures of the…

A: Osteoporosis causes bones to become brittle and weak, to the point where a fall or even little…

Q: What pharmaceuticals or chemical that can be derived from corn husks?

A: Introduction: Corn Husks are the outside green leaves on a cob of corn, that we usually peel off and…

Q: Consider the complete oxidation of one mole of simple TAG containing behenic acid residues (22:0).…

A: Fatty acids are oxidized through beta-oxidation followed by the TCA cycle. Beta-oxidation occurs in…

Q: If I want to make a 100mL buffer that has 2% SDS, 100mM tris pH 8, 10mM EDTA, and proteinase K…

A: Introduction: Buffer is defined as a solution that resists change in pH on the addition of acid or…

Q: Please state if the statements are true or false. 1. Xylose is a pentose and a ketose 2. Louis…

A: Xylose is a sugar. Sugar molecules are also known as carbohydrates. Carbohydrates are composed of…

Q: Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′…

A: Post transcriptional modification in Eukaryotic mRNA occurs by its enzymatic caping. The capping of…

Q: toxicity of cyanide (CN-) results from its binding to the iron atoms of the cytochrome aa3 (complex…

A: The toxicity of cyanide (CN-) results from its binding to the iron atoms of the cytochrome aa3…

Q: NH3 eo

A: The lipid molecules are amphipathic molecules which means they have polar and non-polar functional…

Q: Compare primary, secondary, tertiary and quaternary structures of protein

A: Proteins are composed of carbon, nitrogen, hydrogen, oxygen, and sulfur atoms. Proteins are…

Q: Explain how these macromolecules break down in the body for energy. Include

A: Metabolism of macromolecules involve catabolic and anabolic reaction. Catabolism refers to breakdown…

Q: The activated form of glucose is added to the non-reducing end of glycogen molecules. True False

A: Glycogen is a branching polymer of glucose that works as energy storage in times of nutritional…

Q: 7. cis 20:5(45,8,11,14,17) 20:5;5,8,11,14,17 w3,6,9,12,15 8. trans 20:5(45,8,11,14,17)…

A: Cis and trans Fatty differ in the arrangement of hydrogen atoms on the double bonded Carbon atom.…

Q: The macromolecules that serve in the storage and transmission of genetic information are __________.…

A: Biomolecules are the organic compounds produced by living organisms. They are primarily made up of…

Q: Describe the fluid-mosaic model of the cell membrane and how it results in a semi-permeable membrane…

A: The principle function of the membrane is to separate the contents of the cell from the exterior.…

Q: Which of the following is MOST soluble in polar solvents? A H3C LOH В с D В OD Oc О А H3C. HO л HC…

A: In the given image, structures A, B, and C represents fatty acids. A is a saturated fatty acid.…

Q: why is energy released when IMFs form in between molecules as they approach eachther

A: In molecular terms, intermolecular forces are the forces of attraction and repulsion between…

Q: It's a three part question based on the chart provided asking: a) Which of these enzymes has the…

A: For an enzyme catalyzed reaction, Km is the substrate concentration that is required to attain half…

Q: Amino acid Ala Asp Arg Cys a-carboxyl group a-amino group pK a pK a 2.35 9.78 1.99 9.90 1.82 8.99…

A: There is a characteristic pH of any amino acid at which their net electric charge becomes zero, it…

Q: Why do you think you need to add NaCl?

A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…

Q: 26. Which of the following amino acids can enter directly into the citric acid cycle intermediates?…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: in every Acetyl CoA entering ETC, how many ATPs are produced?

A: Glycolysis as well as the TCA cycle both are processes involved in cellular cellular metabolism. In…

Q: Is the following statement true or false?: Saturated fats have higher melting point than unsaturated…

A: Fatty acids are the simplest form of lipids/ They are long-chain hydrocarbons with one carboxyl…

Q: Identify (1) the group where the lipid belongs, and (2) determine whether the lipid is saponifiable…

A: Lipids are amphipathic molecules which means they have both polar and polar groups present in their…

Q: Match the test in column B that will best differentiate the lipids in column A.…

A: The biological macromolecules that are found in living organisms are carbohydrates, proteins,…

Q: he amino acid alanine, shown below, contains all of the following functional groups except A. an…

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: You obtain the following results for the transport of an amino acid into bacteria. Based on this…

A: The cell membrane presents a hydrophobic barrier that separate the interior of the cell from the…

Question

Based on image of protein (enzyme), need to know:

a) Number of amino acids and length (Angstroms) of helix denoted as H2.

b) Name the post-translational modification (PTM) the enzyme has underwent.

c) Name chemical reagent to undo this PTM and number of equivalents of reagent needed.

C-Terminus
Cys 133
Cys 50
H2(39-57)
Cys 126
Cys 26
Cys 51
Cys 98
H3(87-109)
Cys 45
Cys 29
Asp 49
W1
His 48
Ks =
SH3(122-126)
Phe 5
Cys 61
SH2(114-118)
Trp 31
SH1(18-22)
lle19
H1(2-13)
Leu 3
N-Terminus
B-wing (75-78,81-84)
Cys 92
Leu 2

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Protein Tertiary structure

VIEW

Answers

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?
In the folded protein, His108 forms a salt bridge with Asp44. The pKa of the imidazole functional group in the side chain of histidine is 6.0. The pKa of the carboxylic acid functional group in the side chain of aspartate is 4.1. How do you think the pKa of the side chain of His108 will change in the folded protein? a. The pKa will be > 6.0. b. The pKa will be < 6.0. c. The pKa will not change. Use chemical reasoning to justify your answer.
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
In a 0.1 M lysine solution, what are the individual concentrations of the protonated C-terminus form of the amino acid versus the non- protonated at pH 4 (pKa = 2.16)
In Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same as thatbetween cytosine and guanine? Do you think that aDNA molecule with a high content of A + T would bemore stable than one with high content of G + C?
PLEASE MAKE THE DR BRUJIN GRAPH From these k-mers construct a de Bruijn graph and determine the sequence of the contig. AGCG ATCT ATGA ATGG ATTC CCCT CCTG CTCT CTGA CTGC CTTT GAAG GATT GCGT GCTC GTTC TATG TCAT TCTA TCTT TGAA TGAT TGGA TGTT TTCA TTCC TTTC
The genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.
Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If the old protein sequence was Ala-Ile-Gln-Ala-Asp, what will be the new sequence encoded by the mutant gene? _________(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Le
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
Alpha-helices have 3.6 amino acid residues per turn, ie a helix 36 amino acids long would form 10 turns, and The axial distance between adjacent residues is 3.5 Angstroms. Beta-helices have two residues per repeat unit which gives the beta-strand a 7 Angstrom pitch. This compares with the alpha-helix where the axial distance between adjacent residues is only 1.5 Angstroms. Then how many residues in an alpha-helix conformation would it take to traverse the same distance as 10 residues in beta-strand conformation?
You have discovered a novel protein that has a pI = 5.5. To study the functional properties of this new protein, your research group has made a mutant that contains two amino acid changes—namely, a surface Phe residue in the normal protein has been replaced by His (side chain pKa = 6.1) and asurface Gln has been replaced by Glu (side chain pKa = 6.0). Is the pI of themutant protein predicted to be greater than, less than, or the same as the pIof the normal protein? Support your answer with the appropriate calculation.