Answered: How many equivalents of ATP are…

How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect nt is incorporated how many equivalents of ATP are required to fix this?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 32CTQ: Explain the events taking place at the replication fork. If the gene for helicase is mutated, what...

See similar textbooks

Related questions

Q: 5'-AAAAACCCCCGGGGGTTTTT-3' is in a test tube. What else needs to go in the test tube to so that we…

A: Here it is not mentioned that how the single stranded DNA is maintained. As the single strand…

Q: 2. a. Research DNA quantitation by UV absorption. Explain what A230, A260 and A280 values represent.…

A: Every biomolecule have an unique absorbance curve of their own. This simply means that, the…

Q: Prokaryotic DNA is normally slightly negatively supercoiled, which can lead to "DNA breathing". How…

A: DNA breathing is defined as the short and temporary or in other words a transient opening of nucleic…

Q: ing the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing…

A: DNA is a double stranded biomolecule. The DNA is usually digested by endonucleases and exonucleases…

Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…

A: The genetic material in most organism is double stranded DNA with the two strands running in…

Q: How would describe the observation of DNA precipitated out of the water-ethanol solution

A: Ethanol precipitation is a process where ethanol is used as an anti-solvent to purify and…

Q: DNA polymerase I has both a 5' to 3' exonuclease activity and a 3' to 5' exonuclease activity.…

A: DNA polymerase are enzymes needed for the replication of DNA

Q: 100 50 104 1 10 104 Cot DNA renaturation curves occasionally show three distinct phases of…

A: A single stranded DNA binds to its complementary strand to reform double stranded DNA is called…

Q: E. coli cells grown on 15N medium are transferred to 14N mediumand allowed to grow for two more…

A: Deoxy ribonucleic acid (DNA) replication is semi-conservative in mature, which implies that each of…

Q: Which of the following enzymes relaxes the DNA double helix to avoid tensional force from…

A: Polymerase enzymes synthesize polymers by adding monomer units through specific bonding patterns.…

Q: Why is DNA pol III still a thing, given that it lacks some of the functionality of DNA pol I - why…

A: The Central Dogma concept is a very important part of Molecular Biology. It states that "DNA makes…

Q: What technique did Meselson and Stahl use to test whether any of these models appeared to be at…

A: Replication of deoxyribonucleic acid (DNA) is a process of producing more copies of DNA. During…

Q: Why is it important that the alcohol used in the DNA extraction is kept cold?

A: The ice cold alcohol, helps to isolate the DNA from a solution.

Q: 40.Would it be possible to start synthesizing the daughter DNA strand without assembling the RNA…

A: DNA replication produces two identical helices from a single helix of DNA. If we refer to the…

Q: 1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA…

A: Deoxyribonucleic acid DNA isolation is referred to the extraction process of DNA from different…

Q: Considering prokaryotes, what is the enzyme that helps hold DNA polymerase III in place when…

A: In prokaryotes, replication is a process by which it makes identical copies of DNA. The process…

Q: Question 45 please

A: Cancer is an abnormal and uncontrolled division of cells, known as cancer cells, that invade and…

Q: 23. What process best describes the action of Taq DNA polymerase? a. Catalyzes hydrolysis of…

A: Taq DNA polymerase is the thermal stable DNA polymerase enzyme isolated from Thermus aquaticus. This…

Q: a)What is the complementary strand of TTGACAGTAAAA? b)List the possible genotypes for an individual…

A: a) Complementary strand has nucleotides AACTGTCATTTT Thymine (T) base pair with Adenine (A) with two…

Q: The TM of a DNA duplex is measured at 55 C. When the concentration is one thousand times higher, the…

A: The Temperature of Melting (Tm) is defined as the temperature at which 50% of double stranded DNA is…

Q: You have a DNA sequence of 1400 bp. To characterize it, you decide to make a restriction map.…

A: DNA is a nucleotide polymer present in living beings.

Q: a) "Out of three E.coli DNA polymerases, DNA polymerases 3 has a high processivity and rate of…

A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…

Q: 30) In the CRISPR system, the targeted DNA sequence is

A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…

Q: Which statement below explains the trick in sanger sequencing that produces fluorescently labeled…

A: DNA sequencing Sequencing of DNA is a method to know the order of nucleotide bases in a DNA strand.

Q: 2. Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in…

A: Literally, replication means the system of duplication. In molecular biology, DNA replication is the…

Q: 25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are the DNA digesting enzymes.

Q: The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA?…

A: Chromosomes are a compact form of DNA wrapped around some proteins and are generally present in a…

Q: What is the relationship between the free energy of supercoiling and the superhelical density? How…

A: Deoxyribonucleic acid (DNA) is a compound made up of two nucleotide bases which wrap around together…

Q: explain why it is far less important for Primase to have proofreading activity than it is for DNA…

A: DNA proofreading is error correction process, in which DNA polymerase checks the each nucleotide…

Q: 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the pMBBS…

A: As per the guidelines, we are supposed to answer only three subparts. Kindly repost the question…

Q: 3. If one measures a 20 ul sample of DNA with an absorbance reading at A280 nm of 0.35 and an…

A: These are questions regarding concentration of DNA.

Q: Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between…

A: Polymerase chain reaction used to make thousands of copies of DNA from very small amount of the DNA…

Q: Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’ A. How…

A: A nucleotide consists of a sugar, a nitrogenous base and a phosphate group. A phosphodiester bond is…

Q: Answer the following questions about Extraction of DNA A. (3) types of DNA B. Reagents needed to…

A: Nucleic acids are macromolecules or biopolymers made up of monomers called nucleotides.…

Q: i the polymerase chain reaction, the DNA denaturation step requires a emperature in the range of ?°…

A: SOL1 In humans, fertilization is the fusion of a human egg or female gamete and sperm or male gamete…

Q: 1. Upon the banana DNA extraction, what do you see in the top portion of the liquid when you look at…

A: DNA (Deoxyribonucleic Acid) is the genetic material of all living organisms whether plant, animal,…

Q: How do we explain the large expected difference in free energy of binding for high fidelity of DNA…

A: The accuracy of DNA replication is most critical to living organisms. The fidelity of replication is…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…

A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…

Q: What is the purpose of adding of (a) warm salt water, (b) detergent, and (c) alcohol on the…

A: Extraction of DNA from a banana involves mashing, filtration, precipitation and extraction.

Q: 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to…

A: Some enzymes are called endonucleases cleave the phosphodiester bonds that exist in the DNA. Some…

Q: 1. a. Draw the primers for this longer strand (consider optimal length):…

A: Introduction PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…

Q: 1. Define the relationship between twist, writhe and linking number. Are the twist and writhe…

A: Twist, with and Linking number are used to define the helical pattern and the orientation of dna…

Q: Single-strand binding proteins keep the two parental strands of DNA separated from each other until…

A: Deoxyribonucleic acid or DNA is the genetic material that is passed on from the parents to the…

Q: enzyme EcoRI. On agarose gel electrophoresis, you observe four bands, 200, 550, 1200, and 4600 bp.…

A: Enzyme Digestion In molecular cloning procedures or restriction cloning, enzyme digestion is the…

Q: 25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are molecular scissors that are used in recombinant DNA technology to cut DNA at…

Q: Calculate the frictional coefficient of a molecule of DNA of 20 base pairs in water at 20C; assume…

A: DNA or deoxyribonucleic acid is a polynucleotide chain made of monomeric units of nucleic acids.…

Q: 1c) Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

18A. How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect nt is incorporated how many equivalents of ATP are required to fix this?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
Provide a brief summary of the Sanger sequencing method.
110.Which of the following best explains the leading daughter DNA strand? A.The gaps within the leading strand are sealed by DNA ligase. B.The leading strand is synthesized by the enzyme primase. C.It is polymerized continuously by DNA polymerase from 5' - 3' direction. D. It is polymerized discontinuously by DNA polymerase from 5' - 3' direction which leaves gaps known as Okazaki fragments.
1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
Explain why the absorption of UV light by double-stranded DNA increases (the hyperchromic effect) when the DNA is denatured.
2) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.
1a Briefly describe or explain what the term "supercoiling" means in the context of DNA structure. What is the difference between positive and negative supercoiling?
Single-strand binding proteins keep the two parental strands of DNA separated from each other until DNA polymerase has an opportunity to replicate the strands. Suggest how single-strand binding proteins keep the strands separated and yet do not impede the ability of DNA polymerase to replicate the strands.