2. This is the same gene as #1, but with a mutation!! (C/G-A/T at base pair 21)a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region...)b. Transcribe and translate the gene now5'- CAAATTAATGGCGGCATTTAAGATGGTGGGATCATTACATTGACTAACG -3'153'- GTTTAATTACCGCCGTAAATTCTACCACCCTAGTAATGTAACTGATTGC-5'--+−−+−−-+---+-- 3. This is the same gene as #1, but with a mutation!! (G/C-C/G at base pair 28)a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...)b. Transcribe and translate the gene nowC.What type of mutation is this?5'- CAAATTAATGGCGGCATTTACGATGGTCGGATCATTACATTGACTAACG-3'513'- GTTTAATTACCGCCGTAAATGCTACCAGCCTAGTAATGTAACTGATTGC -5'+--+----+--−+−−

Gene is known as the physical and functional unit of heredity. These are present at the fixed locus…

2. This is the same gene as #1, but with a mutation!! (C/G-A/T at base pair 21) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region b. Transcribe and translate the gene now 5'- CAAATTAATGGCGGCATTTAAGATGGTGGGATCATTACATTGACTAACG 1 3'- GTTTAATTACCGCCGTAAATTCTACCACCCTAGTAATGTAACTGATTGC ---+--- -3' 5 -5'

2. This is the same gene as #1, but with a mutation!! (C/G-A/T at base pair 21) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region b. Transcribe and translate the gene now 5'- CAAATTAATGGCGGCATTTAAGATGGTGGGATCATTACATTGACTAACG 1 3'- GTTTAATTACCGCCGTAAATTCTACCACCCTAGTAATGTAACTGATTGC ---+--- -3' 5 -5'

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 7TYK

See similar textbooks

Similar questions

1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
4. If a DNA triplet is CGA A. What is the mRNA codon? B. What is the tRNA anticondon? C. What amino acid does the mRNA code for? 5. If 18% of the nucleotide bases in a DNA molecule are Guanine (G) A. What % of the bases are cytosine (A)? B. What % of the bases are adenine (A) and thymine (T) combined? C. What % of the bases are thymine alone?
1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the functional mRNA? b.) what is the sequence of the 25th codon? c.) what is the sequence of the stop codon? 2. If the mRNA transcribed for this gene will be translated into a functional protein, a.) how many amino acids will be used to build the polypeptide chain? b.) what is the amino acid coded by the 25th codon? c.) what is the amino acid coded by the last codon? 3. If the above gene is one of the three structural genes of the lac operon that codes for the protein/ enzyme responsible for breaking lactose into two molecules of simple sugars, a.) what triggers the activation of this gene? b.) what triggers the inactivation of this gene? c.) what substance is attached to the operator region of the operon in the absence of activator? d.) what gene is responsible for the synthesis of the substance used to attach in the operator region in the absence of activator? e.) what…
1. If the gene above is transcribed into a functional mRNA,a.) how many codons will be carried by the functional mRNA?b.) what is the sequence of the 25th codon?c.) what is the sequence of the stop codon?2. If the mRNA transcribed for this gene will be translated into a functional protein,a.) how many amino acids will be used to build the polypeptide chain?b.) what is the amino acid coded by the 25th codon?c.) what is the amino acid coded by the last codon?
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. What would be the amino acid sequence encoded by the mRNA5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
1. If a mutation occurs in a coding region a. it will cause a change or changes in the normal (wild type) amino acid sequence. b. the protein may not form correctly and as a result does not perform the intended function. c. the type of mutation can be a missense mutation if there is some or limited protein function. d. the type of mutation can be a nonsense mutation if there is no protein function. e. all of the above 2. If a mutation occurs in a non-coding region: a. it will cause no change in the normal (wild type) amino acid sequence. b. the protein is unaffected and still functions correctly. c. the type of mutation is called a silent mutation. d. the protein may not form correctly and as a result does not perform the intended function. e. all of the above
1.A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine 2. Active transcription does not occur in regions of chromatin loops that are located ________. Group of answer choices a. A large distance away from the MARS b. Within the euchromatin c. Near the MARS d. A large distance from the telomere 3. Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent mutation? Group of answer choices a. 5′-AUG GUU AGA GUU GAA AAA-3′ b. 5′-AUG GCU UGA GUU GAA AAA-3′ c. 5′-AUG GCU AGA GUU GGA AAA-3′ d. 5′-AUG GCU CGA GUU GAA AAA-3′
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)
The DNA sequence below is from the center of a protein coding region. 5 10 15 20 25 30 5’ …… TATCC TAGAG CATAA TTTCG AGATA GCTAG …… 3’ 3’ …… ATAGG ATCTC GTATT AAAGC TCTAT CGATC …… 5’ a) Which strand is coding strand? b) What is the sequence of the encoded polypeptide? A mutant gene has GC (bold) to TA substitution @ position 20. c) What is the sequence of the mutant polypeptide d) What effect is the mutation likely to have on function of the protein? Explain with reasoning.