1. For this gene (I marked the +1 site) a. Identify the promoter, template, and coding strand b. Transcribe c. Translate 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATCATTACATTGACTAACG -3' 1 5 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAGTAATGTAACTGATTGC -5'

1. For this gene (I marked the +1 site) a. Identify the promoter, template, and coding strand b. Transcribe c. Translate 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATCATTACATTGACTAACG -3' 1 5 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAGTAATGTAACTGATTGC -5'

Name: 3. For this gene (I marked the +1 site)a. Identify the promoter, temp
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 3. For this gene (I marked the +1 site)a. Identify the promoter, template, and coding strandb. TranscribeTranslateC.5'- CAAATTAATGGCGGCATTTACGATGGTGGGATCATTACATTGACTAACG -3'153'- GTTTAATTACCGCCGTAAATGCTACCACCCTAGTAATGTAACTGATTGC -5′-+--+-----+−−·---

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 9RQ: Three different bacteria species have the following consensus sequences upstream of a conserved...

See similar textbooks

Similar questions

1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C
1)Which of the following would represent mRNA for the above minigene? a.) AUG CGC GUU CCC GUG UAA b.) UUA CAC GGG AAC GCG CAU c.) AAU GAG CCC AAG CGC GAU 2) Of the following types of RNAi, which one is the most stable? piRNA, miRNA, siRNA, circRNA 3) Identify sense from antisense in this fake minigene. 5’TTA CAC GGG AAC GCG CAT3’ 3’AAT GTG CCC TTG CGC GTA5'
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
4. Some transposases use extensive DNA replication to leave one copy of the element behind in a process called ____________________.A. persistent transpositionB. chronic transpositionC. exchange transpositionD. replicative transpositionE. none of the above 5. Which of the following is not an example of a transposable element found in bacteria?A. Tn5B. Tn10C. IS1D. IS903E. Xis 6. Besides a transposase, many common composite transposons in bacteria encode genes for:A. Toxin productionB. Antibiotic resistanceC. DNA repairD. Homologous recombinationE. None of the above
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
1. (a) cleaves both strands of the target DNA CRISPR repeat sequences gRNA Cas9 nuclease tracrRNA (b) encodes Guide RNAs CRISPR repeat sequences gRNA Cas9 nuclease tracrRNA