Answered: 2. What happens during translation? is…

2. What happens during translation? is read and Possible sentence frame: Translation is the process in which is made. This happens by.

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SQ: Match the terms with the best description. __ genetic message a. protein-coding segment __ promoter...

See similar textbooks

Related questions

Q: 5. Consider eukaryotic transcription: a) Draw a eukaryotic gene and label key sequences. (5 points)

A: A eukaryotic gene, consists of a set of sequences that appear in mature mRNA interrupted by introns.…

Q: Here is your sequence of DNA to use to do transcription, and then translation:…

A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA

Q: Although DNA gets all the glory, it’s actually RNA that does most of the work when cells produce…

A: In species, gene expression is a vital and essential process that helps to produce proteins by using…

Q: . Which of the following statements about the flow of genetic information is correct? A. Translation…

A: Genes are the basic hereditary molecules that carry hereditary information in them. They are present…

Q: Indicate 2 ways which ensure DNA fidelity when carrying the message to protein which occur in the…

A: DNA fidelity refers to the ability of the DNA polymerase to avoid or rectify the errors made in the…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: 3)What would be the third amino acid produced by the DNA strand: T A C C G A G T C A C G (Hint: use…

A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…

Q: Describe the process of transcription. Your answer should be at least a full paragraph (3-7…

A: Question - Describe the process of transcription. Your answer should be at least a full paragraph…

Q: 1. Translation is the biological polymerization of amino acids into polypeptide chains from MRNA. 2.…

A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…

A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…

Q: 5. A molecule with three bases on one end that can bind an amino acid on the other end during ge…

A: The central dogma is a vital process that is responsible for deducing the flow of genetic…

Q: 5. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: point mutation - change in single nucleotide sequence which alter the amino acid .

Q: 5' Capping and 3' polyadenylation of eukaryotic mRNA : a. Destabilize MRNA b. are required for…

A: Introduction:: The correct choice is option (b).

Q: 1. This image summarizes how computers sort and order DNA fragments to produce a final sequence of…

A: Nucleic acid is chemically different than protein and carbohydrate . This difference helps in…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC

A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…

Q: 2. Identify the following structures when given images such as the ones below: ● process of…

A: Introduction The cell is the basic structural and functional unit of life present in all living…

Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…

A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions…

Q: Compare and contrast: TRANSCRIPTION and TRANSLATION Give 2 similarities and 2 differences. Be…

A: Introduction DNA acts as a genetic material in our body. DNA contains gene or the basic unit of…

Q: Build" the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly, letter by…

A: The process of RNA synthesis with the help of template strand of DNA is called transcription. It is…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: DNA acts as genetic material in most organisms. DNA gets transcribed into mRNA by an RNA polymerase…

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: what 3 parts make up processed piece of mRNA

A: A post-transcriptional modification takes place after transcription of DNA to mRNA strand in the…

Q: . An alternative form of a gene is called an

Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…

A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: 4. Look at the picture above. What do you notice about RNA's nucleotides (base pairs) compared to…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation

A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…

Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…

A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…

Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Q: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: 4. Use the RNA strand below and list the appropriate amino acids. AUG AGU UAC CCG GGA

A: Introduction :- Organic molecules known as amino acids have side chains unique to each amino acid as…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: Which statement is CORRECT? O the primary transcript of RNA is larger than the mRNA O the primary…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: Energy that drives translation is provided mainly by______ . a. ATP c. GTP b. amino acids d. all of…

A: Translation is the process of protein synthesis using messenger RNA as a template.

Q: 1. Using the DNA provided transcribe DNA into mRNA. 2. Use the mRNA strand you created and break it…

A: DNA is the main genetic material present in most organisms and stores all the genetic information of…

Q: 1. When can a mutation on the DNA cause shortening of the translation product? Give a specific…

A: A single nucleotide or nucleic acid can be affected by a point mutation. When one base is replaced…

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.

A: Transcription is the process in which RNA is made from DNA, while translation is the process in…

Q: 1. What happens during transcription? Possible sentence frame: Transcription is the process in which…

A: Need to fill the blanks related to transcription process.

Q: 4. Mark the following statements about the genetic code as TRUE or FALSE: The genetic code is…

A: Genetic code is a set of three nucleotides where one triplet is called as one codon.

Q: 5. When can a mutation on the DNA cause shortening of the translation product? Give a specific…

A: Mutation is the phenomenon in which the DNA sequence is altered. This may occur spontaneously.…

Q: 1) The direction of transfer of genetic information in all living things (as defined in the central…

A: it is the process of conversion of the DNA into the functional product it explains how genetic…

Concept explainers

Cancer Therapy

Question

2. What happens during translation?
Possible sentence frame: Translation is the process in which
is made. This happens by
is read and
Is your answer 3-5 sentences?
Did you use at least 5 vocab words?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

2. "Build" the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly, letter by letter.
Match the terms with the best description. __ genetic message a. protein-coding segment __ promoter b. KN A polymerase binding site __ polysome c. read as base triplets __ exon d. removed before translation __ genetic code e. occurs only in groups __ intron f. complete set of 64 codons
1. Discuss the difference between intron and Exon
4. Indicate whether each of the following words orphrases applies to proteins, DNA, or both.a. a macromolecule composed of a string of subunitsb. double-strandedc. four different subunitsd. 20 different subunitse. composed of amino acidsf. composed of nucleotidesg. contains a code used to generate othermacromoleculesh. performs chemical reactions
How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'
4.Write an RNA structure having 8 nucleotides.
12. The flow of genetic information usually takes place from a) RNA to DNA to proteins b) proteins to RNA to DNA c) DNA to RNA to proteins d) none of these
Describe the process of transcription. Your answer should be at least a full paragraph (3-7 sentences) and include RNA processing (hint there are 3 ways in which mature mRNA is different from primary or Pre-mRNA). Correct vocabulary should be used.
The work ‘Hybridization’ in DNA finger printing meansa) Pairing between the nucleotides of DNA sample with probeb) Pairing between the nucleotides of DNA and mRNAc) Pairing between the nucleotides of probe with mRNAd) Pairing between the nucleosides with mRNA
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
7c when I biologist constructs a cDNA library, the biologist began isolating mRNA from hydra cells. name a enzyme could have been used to make complementary DNA‘s using those mRNA molecules as templates.
9. Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d) polypeptideà amino acids