8:47ll 5G% 4Chapter 9 DNA worksheet 2022.d...2. Write the mRNA transcript from the DNA template in question 1.Remember your enzyme for RNA polymerase must add RNA nucleotidesstarting with the 5' direction and moving to the 3' direction. So for theMRNA copy the strand of DNA that is 3'-5')3. Refer to the codon chart at the bottom of the page. Translate themRNA into a polypeptide using the following rules. (2 points)Direction of translation of mRNA is from 5' to 3'.1.MRNA codons are read in groups of three nucleotides.3.Translation must begin at the START codon.4.the STOP codon terminates translation.2.THIRDLETTERSECOND LETTERUTulUUU PheUUC PheUUA LeuUUG LeuAUGU Cys UJUGC Cys CUCU Ser UAU TyrUCC Ser UAC TyrUCA Ser UAA STOP UGA STOPAUCG Ser UAG STOPUGG Tp GCCUU LeuCÚC LeuCỦA LeuCUG LeuAJAUU IleAUC IleAUA IleAUG Met STARTACG ThrAAG LysGGUU ValGUC ValGUA ValGUG ValCCU Pro CAU HisCCC Pro CAC HisCCA Pro CAA GlnCCG Pro CAG GlnACU ThrAAU Asn AGU SerАCС ThrAAC AsnACA Thr AAA LysCGU Arg UCGC ArgCCGA Arg ACGG ArgIGJuAGC SerCAGA ArgJAGCU Ala GAU Asp GGU GlyGCC Ala GAC AspGCA Ala GAA GluGCG Ala GAG Glu GGG Gly GAGG ArgUGGC GlyCGGA Gly A4. A set of DNA has been given that is 40% T bases. What are thepercentages of the other bases in this sequence A,C, and G? (2 points)21000000DashboardCalendarTo DoNotificationsInbox因

Name: 8:47ll 5G% 4Chapter 9 DNA worksheet 2022.d...2. Write the mRNA transc
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 8:47ll 5G% 4Chapter 9 DNA worksheet 2022.d...2. Write the mRNA transcript from the DNA template in question 1.Remember your enzyme for RNA polymerase must add RNA nucleotidesstarting with the 5' direction and moving to the 3' direction. So for theMR

*NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Science

Biology

2. Write the MRNA transcript from the DNA template in question 1. Remember your enzyme for RNA polymerase must add RNA nucleotides starting with the 5' direction and moving to the 3' direction. So for the MRNA copy the strand of DNA that is 3'-5')

2. Write the MRNA transcript from the DNA template in question 1. Remember your enzyme for RNA polymerase must add RNA nucleotides starting with the 5' direction and moving to the 3' direction. So for the MRNA copy the strand of DNA that is 3'-5')

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
30) In the CRISPR system, the targeted DNA sequence is
40.Would it be possible to start synthesizing the daughter DNA strand without assembling the RNA primer first? Why? Why not? A.Yes, because the 5' PO4 is already present in the DNA strand which will be used as a template. B.No, because the RNA primer which contains the free 3' OH in its ribose has to be synthesized by primase first. C.No, because the RNA primer which contains the free 5' PO4 in its ribose will not be synthesized by primase. D.Yes, because the 3' OH is already present in the DNA strand which will be used as a template.
5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.
8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAACGTTAC 8b. Where did the mutation take place?
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… a)Locate the sequence encoding the five amino acids of the polypeptide, and identify the template and coding strand.
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
22-71 Indicate whether each of the following statementsinvolving differences between DNA and RNA moleculesis true or false.a. Base pairing occurs in DNA but not in RNA.b. Both DNA and RNA are double-stranded molecules.c. RNA molecules are much larger than DNAmolecules.d. The base T in DNA is replaced by the base A in RNA
18) How can we, experimentally, test the relationship between a phenotype or a phenotypic trait and a DNA sequence? a.. amplifying by PCR b. detecting its mRNA c. mutagenesis d. sequencing DNA 19) Which of the following types of bonds are found in the structure of DNA and/or were study objects with radioactivity in the experiments and findings of Hershey and Chase? (two apply) a. peptides (between NH2 and COOH) b. of hydrogens (by electronegativity) c. covalent (shared electrons) d. sulfur (S-S bridges) e) ionic (between positive and negative) 22) The first plant whose genome was sequenced was: a.wheat b.golden rice c.Tomato savor (tomato) d. Arabidopsis thaliana
30. Which of the following is FALSE when comparing RNA and DNA? A.are composed of nucleotides that contain a phosphate group, a pentose sugar, and a nitrogenous base. B. Both contain nucleotides connected by phosphodiester linkages. C. Both have a 5’ end and a 3’ end. D. Both are composed of identical nucleotides.
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide. Please explain step-by-step how exactly you go from the DNA sequence given to the final answer.