23 Environmental factors typically activate genes in a cell by causing the cell to-A produce identical daughter cells through mitosisB form haploid gamete cells through meiosisfuse with another cell to increase the size of its genomeD transcribe specific DNA segments to mRNA for translationBiologyPage 16

Name: 23 Environmental factors typically activate genes in a cell by causin
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 23 Environmental factors typically activate genes in a cell by causing the cell to-A produce identical daughter cells through mitosisB form haploid gamete cells through meiosisfuse with another cell to increase the size of its genomeD transcribe spe

The gene expression of a cell is controlled by transcription and translation which helps in the…

Answered: 23 Environmental factors typically…

Science

Biology

23 Environmental factors typically activate genes in a cell by causing the cell to

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 8TYK

See similar textbooks

Similar questions

In bacteria: a. several chromosomes undergo mitosis. b. binary fission produces four daughter cells. c. replication begins at the origin (ori), and the DNA strands separate. d. the plasma membrane plays ab important role in separating the duplicated chromosomes into the two daughter cells. e. the daughter cells receive different geneti information from the parent cell.
The fusing of Golgi vesicles at the metaplhase plate of dividing plant cells forms what structure? cell plate actin ring cleavage furrow mitotic spindle
After DNA replication, a eukaryotic chromosome ______. a. consists of two sister chromatids b. has a characteristic X shape c. is constricted at the centromere d. all of the above
Which of the following statements about eukaryotic chromosomes is false? (a) eukaryotic chromosomes have free ends (b) telomeres contain protein-coding genes (c) telomerase lengthens telomeric DNA (d) telomere shortening may contribute to cell aging (e) cells with active telomerase may undergo many cell divisions
In intervals of interphase, G stands for ______. a. a gap b. growth c. Gey d. gene
The mitotic spindles arise from which cell structure? centromere centroscme kinetochore cleavage furrow
The ends of the linear chromosomes are maintained by helicase primase DNA pol telomerase
Match the terms with the best description. __ genetic message a. protein-coding segment __ promoter b. KN A polymerase binding site __ polysome c. read as base triplets __ exon d. removed before translation __ genetic code e. occurs only in groups __ intron f. complete set of 64 codons
26. Once the end product of a metabolic pathway shuts down the pathway, this kind of inhibition is known as A competitive inhibition B.ncompetitive inhibition C noncompetitive inhibition D. Feedback inhibition 27. Which of the following is not part of meiosis-1 A Prophase-1 B. pro metaphase C. metaphase-I D. anaphase-1 E telophase-I F. all given choices are part of it
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
28. Approximately 50 % of the human genome is composed of a. protein-coding genes b. ribosomal RNA genes c. mobile genetic elements like transposons and retrotransposons d. introns e. promoter sequences.
The chromosomes become visible under a light microscope during which stage of mitosis? prophase prometaphase metaphase anaphase