3. Using the double stranded bacterial sequence provided below: ( - Indicate the promoter sequence by underlining the TATAAT sequence and label the nontemplate (NT) strand and the template strand (T) - Identify the +1 transcription start site and label as +1 and drawa vertical line in the DNA sequence between -1 and +1. - Identify which strand of DNA will be transcribed and bold/circle the specific strand and specific nucleotides that will be transcribed. - Transcribe the appropriate part of the DNA into mRNA. Indicate the 5' and 3' ends of the new MRNA. 5' GGCATTGCATAAAGTCGAGCATTATACGGCATTAGGATGGC 3' 3' СCGTAACGTATTTCAGСТCGTAATАTGCCGTAATCСТАССG 5'

Q: 5. Consider eukaryotic transcription: a) Draw a eukaryotic gene and label key sequences. (5 points)

A: A eukaryotic gene, consists of a set of sequences that appear in mature mRNA interrupted by introns.…

Q: 8. The following diagram represents the Christmas-tree-like structures during transcript On the…

A: E. Eliminators are viewed downstream of the quality as deciphered, and ordinarily happen…

Q: 1. For each of the following, explain how eukaryotic transcriptional initiation would be affected.…

A: According to bartleby expert guidelines, when multiple questions are posted we are allowed to answer…

Q: 1. This complex assembles and organizes nucleosomes and contributes to gene repression Group of…

A: the answers to these multiple-choice questions are given below.

Q: 3. List the sequences for the "stop" codons.

A: A codon is a three-nucleotide long stretch present in the messenger RNA (ribonucleic acid). It codes…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: 2. The following schematic shows the chromosomal location of Gene 1 and Gene 2. The corresponding…

A: g)It will not be same. The direction of transcription is always determined by the location of the…

Q: 6)Select ALL of the following that apply to transcription. Select one or more: a. occurs in the…

A: Transcription is that the method by which the information during a strand of deoxyribonucleic acid…

Q: What is the central dogma? What are the compounds involved in this process? (Keywords: transcription…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: 1. Draw a schematic of a stretch of DNA (horizontally) in the space below to represent a gene a. Put…

A: DNA deoxyribonucleic acid is a genetic material in many organisms this genetic material inherited to…

Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhvdrolvzed RNA,

A: RNA (ribonucleic acid) is a single chain polymer of nucleotides that is linked by phosphodiester…

Q: 8. Which of the following best describes the messenger RNA (MRNA) molecules found in prokaryotes? A.…

A: Disclaimer : Since you have asked multiple question, we will solve the first question for you. If…

Q: The diagram below shows a section of double-stranded DNA undergoing both transcription and…

A: DNA replication is the process in which the DNA copies are made by the action of several enzymes…

Q: What is a consensus sequence? What are the components of RNA polymerase and what are their functions

A: RNA polymerase is an enzyme that catalyzes the synthesis of RNA from RNA template.

Q: 1. From standpoint of replication and transcription, explain how RNA polymerase is allowed to…

A: Replication is the process of formation of two identical DNA copies from one parent DNA.For this…

Q: 3. In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…

A: Deoxyribonucleic acid (DNA) contains 2 segments referred to as coding and template strand. These…

Q: Why aren't ssb proteins necessary in transcription?

A: The function of SSB protein is to prevent the recoiling of parent strands during replication. As we…

Q: 3. Explain the three stages of transcription in Eukaryotic cell. Identify all enzymes used with…

A: The transcription is the process by which mRNA is produced from the DNA template and during the…

Q: 1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA…

A: Transcription is the process of copying information from a strand of DNA to a newly synthesized…

Q: 1. During RNA splicing, the of the precursor mRNA are being removed. Exons Introns Promoters…

A: RNA splicing is a process by which non coding sequences of RNA are removed. The coding sequences…

Q: 19.Identify the single most correct choice:  a) Without an exception, all enzymes are proteins. (…

A: Ans: e) b and d

Q: The specific sequence component of the bacterial promoter located 10 base pairs upstream of the…

A: A promoter is cis-acting , position dependent DNA sequence which is necessary for accurate and…

Q: scientist, Dr. Doom would like to create a novel antibiotic by targeting translation in bacterial…

A: Transcription is a process in which formation of transcript of RNA from DNA by the process of…

Q: 2. For each of the following types of gene regulation, indicate whether it occurs in eukaryotes…

A: Gene regulation is the term used to describe any mechanism used by a cell to increase or decrease…

Q: 2. What do you predict would happen if you created-a RNA with an anticodon of 5'-CAA-3' that is…

A: The translation of the proteins takes place as the mRNA having the codons are fitting into the…

Q: 2. There is no sigma factor on the RNA polymerase II. How does RNA polymerase Il know where to start…

A: Usually in Eukaryotic transcription initiation the transcription factor identifies promoter and then…

Q: the two factors that bind directly to the DNA at specific sequences are TFID  and TFIIB, in genreal…

A: Transcription is the process by which the information in a strand of DNA is copied into a new…

Q: 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan…

A: Introduction  Gene Regulation: Expression of gene is highly regulated in both prokaryotes as well as…

Q: 18. While studying a human patient with hemophilia, you have discovered that the second exon of the…

A: Transposable elements also are known as jumping genes. These are those DNA sequences that can change…

Q: What codons ar e found in the mRNA for the two mutated DNA?

A: Answer 1: - There are 14 codons in the original DNA sequence. Answer 2:- Similarly, there are 14…

Q: Differentiate transcription in both prokaryotic and eukaryotic cells. 2.Discuss the encoding of…

A: Prokaryotes have simple cellular organisation with no nucleus and membrane bound organelles where as…

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase…

A: The image shows 10 statements. We have to determine whether the statement is True or False. The…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame by filling…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: 1- How does the sigma factor control whether it can start transcription together to give way to RNA…

A: Transcription is the process where one strand of DNA is transcribed into RNA is known as antisense…

Q: 5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the…

A: Transcription is the synthesis of RNA and translation is the synthesis of proteins. There is a…

Q: . Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous…

A: 1.Answer-- correct option is (b)        Nucleotide excision repair

Q: Identify the three protein complexes/enzymes important in eukaryotic DNA replication A. Enhancer,…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: 8. The following diagram represents the Christmas-tree-like structures during transcription. On the…

A: Introduction: A single nucleic acid strand has a backbone composed of repeating pentose-phosphate…

Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…

A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…

Q: Do you think it matters which protein is mutated? Is one protein more important than another?  How…

A: Exons and Introns are the regions of mRNA, while maturation of mRNA (splicing) the Exons are kept…

Q: 3.explain why the following statement is false. "Interaction of specific transcription factors and…

A: Note: Since you have posted multiple independent questions in the same request, we will solve the…

Q: 6. Which of the following is NOT a similarity between replication and transcription? A) Both…

A: The process of DNA replication is used to replicate genetic information to create two copies of the…

Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…

A: In the given diagram of splice donor site and acceptor site: - Splicing take place when a group of…

Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…

A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…

Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.

A: Transcription is the process in which RNA is made from DNA, while  translation is the process in…

Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…

A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…

Q: 1. What happens during transcription? Possible sentence frame: Transcription is the process in which…

A: Need to fill the blanks related to transcription process.

Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…

A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…

Q: 1) Which of the following complexes contributes to the transcription of cyclin E? a) Cdk1/cyclin A…

A: 1) The cell cycle is a sequence of events that is occurring in a ordered fashion which results in…

Q: 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene…

A:

Violence

Violence is defined as a physical act that causes or is intended to cause harm. Violence can cause physical, emotional, or both types of harm. Violence is defined by the World Health Organization as the intended use of physical force and power that causes threat or harm against oneself, another person, or against a community or group, and has the potential to cause damage, death, mental distress, maldevelopment, or poverty.