1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene product. 3' TAC GAA ATA ACA GTA CGA CCA AAA CTT TAC ACT S 2. Assume the following nucleotide changes in the DNA strand above and write down the amino acid sequences. a. Insert thymine after position 10 of the base. b. Delete base number 9. c. Replace position 18 with guanine. d. Replace the 10h to 12" nucleotides with TAG. e. Replace the 3d to 5 nucleotides with ATT.

1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene product. 3' TAC GAA ATA ACA GTA CGA CCA AAA CTT TAC ACT S 2. Assume the following nucleotide changes in the DNA strand above and write down the amino acid sequences. a. Insert thymine after position 10 of the base. b. Delete base number 9. c. Replace position 18 with guanine. d. Replace the 10h to 12" nucleotides with TAG. e. Replace the 3d to 5 nucleotides with ATT.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide bases
Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules _______. a. are from different organisms b. have different lengths c. have different nucleotide compositions d. have different genes
The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
5. Consider the following DNA template strand:3’ GCA- AAA-CAA-ATA-GTG 5’Using the following sequence, identify:a. The base sequence in the DNA information strandb. Assuming that no introns are present, identify the codons present in the mRNA transcribed from the DNA template strandc. The anticodons in the tRNA that with interact with the mRNA codons in (b).d. The amino acids that will be carried by the tRNA (from c) molecules
1. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? a. C b. G c. A d. T 2. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′ 3. This complex assembles and organizes nucleosomes and contributes to gene repression a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 4. Amino acids at the N-terminal end of eukaryotic polypeptides that contain the information required for the post-translational processing and…
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. The enzyme that fills the gaps between the Okazaki fragments is ________. a.DNA polymerase b.Helicase c. Ligase d. Primase 2. After helicase unwinds the two DNA strands, ____________ bind to the single stranded DNA. This keeps the two single stranded DNA separated. a. Topoisomerase b. Single stranded binding proteins c. Ligae d. DNA polymerase 3. To synthesize a new strand of DNA, DNA polymerase requires: a. inorganic phosphate b.dNTPs (dATP, dCTP, dGTP, dTTP) c. a free 3' OH group d.ATP e. template DNA Please answer asap and type your answer and do not copy from anywhere please