3.1 The diagram below represents protein synthesis that takes place in a human cell. In the diagram, the first 7 triplets of nitrogenous bases that form part of the gene coding for one chain of the haemoglobin (protein) is represented. DNA template 1 2 3 4 5 6 7 TTT CÁC GTG GAC TGA GGA CTC CTC 11 GAG GAG MRNA 8. 묘 CAC 9 10 GTG CAC CTG ACT CCT GAG GAG 3.1.1 How many of the following are coded for in the DNA template sequence represented in the above diagram: (a) RNA nucleotides (b) Genes (c) Amino acids 3.1.2 Write down the nitrogen base sequence of mRNA triplets labelled 8–11. 3.1.3 Using the table below, determine the amino acid sequence coded by triplet number 1 to triplet number 4. Anticodons on TRNA CUC GUG Amino acid Glutamate Histidine Proline Leucine Threonine Valine GGA GAC UGA CAC

3.1 The diagram below represents protein synthesis that takes place in a human cell. In the diagram, the first 7 triplets of nitrogenous bases that form part of the gene coding for one chain of the haemoglobin (protein) is represented. DNA template 1 2 3 4 5 6 7 TTT CÁC GTG GAC TGA GGA CTC CTC 11 GAG GAG MRNA 8. 묘 CAC 9 10 GTG CAC CTG ACT CCT GAG GAG 3.1.1 How many of the following are coded for in the DNA template sequence represented in the above diagram: (a) RNA nucleotides (b) Genes (c) Amino acids 3.1.2 Write down the nitrogen base sequence of mRNA triplets labelled 8–11. 3.1.3 Using the table below, determine the amino acid sequence coded by triplet number 1 to triplet number 4. Anticodons on TRNA CUC GUG Amino acid Glutamate Histidine Proline Leucine Threonine Valine GGA GAC UGA CAC

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 18RQ: During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol...

See similar textbooks

Similar questions

During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
True of False 9) Gels are read from left to right. Answer: 10) Functional segments of genes (introns) code for proteins, molecules that carry out most cellular functions. Answer: 11) The human genome contains small, repetitive DNA elements that have become randomly inserted into it over millions of years. Answer:
DNA replication is semi-conservative, this statement means that Question 6 options: a) the new DNA molecules that are made are not identical to the original DNA molecule. b) the new DNA molecules that are made are only partially DNA since RNA primers are included. c) the new DNA molecules that are made are composed of one strand of the old DNA molecule and one strand of new DNA. d) of the two new DNA molecules made, one is entirely new DNA and one is entirely old new. e) the new DNA molecules that are made have a mixture of old and new DNA in each strand of the DNA duplex, randomly interspersed.
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
Results obtained from a Nano Spec. DNA samples collected: ng/uL A260/A80 A260/A230 E.coli genomic DNA 45.3 1.68 0.84 pEMBL1.9 26.0 1.80 1.09 pBluescript 82.1 1.90 1.89 What does this results tell us about the purity of the DNA samples? What are possible contaminations that may have occured?
35. What is one use of recombinant DNA? Choose all that are correct. Group of answer choices genetically modified children No answer text provided. genetically modified crops No answer text provided. growing new mammals prevent clotting in the heart make insulin
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Regular DNA replication Question 3 options: Occurs through the addition of nucleotides to the end of the parental DNA molecule Results in the formation of four new DNA strands Uses one RNA molecule as a template for the creation of a new strand Begins when two DNA molecules join together to exchange segments Not listed
Please help me answer this reviewer. Determine what the statement is describing. Fill in the blanks with the correct/best answer. 1. A fermentation method used by several industries like the pharmaceuticals, food, textile etc., to produce metabolites of microorganisms using solid support in place of the liquid medium. answer: 2: Whole fish whose DNA has been purposefully altered by directly integrating (or deleting) one or several genes to introduce or modify a targeted character. answer: 3. The process of transferring genetic materials into a living cell using glass micropipettes or metal microinjection needles. answer: 4. Preservation of components of biological diversity outside their natural habitats. Thank you very much for your help
Which of the following is NOT correct concerning the initiation of replication in E. coli? Question 29 options: A) It involves a region of the DNA called oriC. B) DnaA proteins bind to the DNA to begin separation of the strands. C) The strands are initially separated at GC-rich regions of DNA. D) Following initial separation, enzymes continue to separate the parental DNA strands around the rest of the chromosome.
LO 64- Explain how Next gen sequencing is applied in different technologies In which of the following scenario would it be best to use Next-gen sequencing? (select all that apply) a-To separate fragments of DNA based on their size- b-To insert a mutation at random in a gene c-To idently a novel pathogen d-To determine the nucleotide sequence of a microbe e- To insert methyl groups to cytosines in a DNA sequence asap please
Please use the below DNAs and complete 4 steps question. Thanks1