1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT (as shown in the diagram). What is the amino acid coded by this triplet?
Q: 1. How many codons are there in the Original DNA sequence? 2. How many codons are there in the MRNA?…
A: Introduction When a DNA gene is disrupted or damaged in such a way that the genetic message carried…
Q: 1. Define the following terms DNA RNA Replication Translation…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…
A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…
Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…
A: transcription is the process by which messenger rna is made from dna .
Q: 1. What are the differences between DNA and RNA? 2. Which process involves copying of DNA…
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: 1. What is the concept of universality of the genetic code? What are the exceptions to this…
A: Introduction The sequence of nucleotides on m-RNA that code for an amino acid is known as genetic…
Q: 7) A strand of MRNA that is 450 nitrogenous bases long will produce a protein containing…
A: Living cells use a collection of rules called the genetic code to translate information found in…
Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF
A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…
Q: 1. What is the complementary strand of sequenced DNA? 2. What is the transcription product of this…
A: Here, template stand is given having direction 3'→5' new complementary strand synthesized in 5'→3'…
Q: The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the…
A:
Q: 6. Write a brief paragraph each to explain what an insertion sequence and a transposon are. 7. What…
A: 1. Inclusion arrangements (Insertion sequences) (ISs) are little bits of DNA which move inside or…
Q: 1. From standpoint of replication and transcription, explain how RNA polymerase is allowed to…
A: Replication is the process of formation of two identical DNA copies from one parent DNA.For this…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: A polymerase is an enzyme that helps to synthesizes long chains of polymers or nucleic acids. It…
Q: 1. Determine what amino acid will be formed from the given DNA strand below:…
A: DNA strands are coiled with each other and form the DNA double helix. Each strand of DNA contains…
Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?
A: DNA is the store house of genetic information. This genetic information expressed by the formation…
Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…
A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: 4. A double-stranded DNA molecule with the sequence shown below produces, in vivo, a polypeptide…
A: Transcription is the DNA dependent RNA synthesis. Process of transcription is catalyzed by RNA…
Q: 2. The organization of DNA requires that replication be performed by a large “machine of proteins."…
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: 1. One strand of DNA has the base sequence: CGATTGGCAGTCAT. Determine the sequence of bases in the…
A: The sequence of bases of complementary mRNA from DNA strand can be determined as follows: DNA mRNA…
Q: 1. Using the central dogma of molecular biology, explain the terms replication, transcription and…
A: Since you have asked multiple questions, we will answer only the first question for you. If you want…
Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…
A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…
Q: What codons ar e found in the mRNA for the two mutated DNA?
A: Answer 1: - There are 14 codons in the original DNA sequence. Answer 2:- Similarly, there are 14…
Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…
A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…
Q: Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins.
A: DNA/RNA are basically called as nucleic acid and it is important class of macromolecules which is…
Q: 4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of…
A: DNA is a polynucleotide molecule that stores genetic and hereditary information. DNA is a…
Q: What is the role of Ligase in DNA replication?
A: DNA is the genetic material present in the nucleus.
Q: If a different point mutation changed the DNA code from ACG to ACT, would that cause a problem with…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: What are the components of the initiation complex for translation
A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…
Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…
A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…
Q: 1
A: INTRODUCTION:- A mutation is any change in the nucleotide sequence of DNA.Some mutations affect…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…
A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…
Q: 4. How is replication different from transcription in terms of product? 5. What do you call each…
A: DNA is the deoxyribonucleic acid which contains the genetic coding of an individual.
Q: How are nucleotides formed?
A: Hi! As you have posted multiple questions and have not mentioned which is to be answered, we are…
Q: 2. Do you think mutation has any direct relationship with codon? Why/Why not? Please explain in your…
A: Mutations are the errors, caused by changes in nucleotide bases inside codones. Two most common…
Q: Discuss the difference between intron and Exon
A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The central dogma of life involves three processes. They are: Replication: - In this process,…
Q: 1. What are the differences between DNA and RNA? 2. What are the similarities between DNA and RNA?
A: Hereditary component of a cell which contains the information of the body and can be transmitted…
Q: 1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T. Determine the sequence of…
A: According to the question, one strand of DNA with the base sequence is given, we have to determine…
Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…
A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…
A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixUsing Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGExamine Table 15-2. Which amino acids are coded by the following codons? (Hint: For the first base [letter] in each of the codons listed below, look at the leftmost column of the table labeled “First Base.” For the secondbase in each codon, look at the top row of bases, and for the third base, look at the column on the right-hand sideof the page).a. UUUb. UCUc. UAUd. UGCe. CUUf. CGAg. CGGh. AAAi. AAGj. GAGk. GGUl. GGCm. GGAn. GGG
- Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
- Please by using the first base of each as the first triplet in a condo, how do I translate two almost identical RNA strand into sequences? You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaaccWhich of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?