A. Consider the following DNA sequence (coding strand) located near the middle of the codingregion of a gene in lampreys. The numbers atop the nucleotides represent the position # of anucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies thesequence of a complete intron.DNA50556065707580855' - CCTGAGTCCGAGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG- 3'IntronA. Which of the following is almost certain to result in a shorter than normal DNA? You maychoosethanInevent,explainchoice(s).moreoneanswer.anyyourI. T→A mutation at nucleotide #59II. G→T mutation at nucleotide #60III. 3 nucleotide deletion in the middle of the intronIV. C>A mutation at nucleotide #54B. In your opinion, could the intron sequence serve as a molecular marker? In your own words,explain your reasoning.C. Suppose the base at position 70 changes to A (adenine), would this be considered a mutation?In your own words, explain your reasoning.

Answer option ll will result in shorter strand

A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGÁGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG, 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may In choose more than one answer. any event, explain your choice(s). I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C→Amutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning.

A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGÁGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG, 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may In choose more than one answer. any event, explain your choice(s). I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C→Amutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning.

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SQ: Match the terms with the best description. __ genetic message a. protein-coding segment __ promoter...

See similar textbooks

Similar questions

State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends labeled.
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
Match the terms with the best description. __ genetic message a. protein-coding segment __ promoter b. KN A polymerase binding site __ polysome c. read as base triplets __ exon d. removed before translation __ genetic code e. occurs only in groups __ intron f. complete set of 64 codons
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
TAG CCG ATA GCT TGA Translate the gene above into a protein . Please write the three letter code of the third amino acid in the sequence in the blank.
State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA
a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
Write a paragraph about transcription, and include the following terms: transcription factors, promoter region, TATA box, RNA polymerase, elongation of RNA, and terminator sequence. DNA sense vs. nonsense strand and 5’ ends. And please include one image of what is happening.
b) Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading