3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs required to service all of the threonine codons? Write out the base sequences of the anticodons of those tRNAs (remember to label the 5' and 3' end of each anticodon sequence).

3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs required to service all of the threonine codons? Write out the base sequences of the anticodons of those tRNAs (remember to label the 5' and 3' end of each anticodon sequence).

Name: 3b) In the real world, where "wobble" pairing is possible, what is the
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs required to service all of the threonine codons? Write out the base sequences of the anticodons of those tRNAs (remember to label the 5' and 3' end of each

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?
Using a table that shows which codon represents which amino acid determine the following: A) The possible codons that encode Serine: B) The amino acids that could be encoded if the 2nd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: C) The amino acids that could be encoded if the 3rd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: D) The amino acids that could be encoded if the 1st position of the UCA codon that encodes Serine was changed to one of the other 3 bases:
1d) What amino acid would a tRNA with the anticodon 5'AGG3' carry?
The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methionine C. Serine
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?
A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
Please by using the first base of each as the first triplet in a condo, how do I translate two almost identical RNA strand into sequences? You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
Is this diagram of tRNA technically incorrect? Shouldn't it be 3' on the left and 5' on the right for the tRNA such that the 5' to 3' codon can match with the antiparallel 3' to 5' anticodon?
Which of these amino acid sequences will most likely favor the formation of a b-pleated sheet secondary structure?
Consider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGA