For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also labeled, what are the first 3 nucleotides of the RNA transcribed from this sequence? +1 510 +10 3' GAGCGACATAATACGATTAT 5' AUA 3' 5' AAU 3' 5' UAU 3' 5' UUA 3' 5' CUA 3'
Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…
A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…
Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…
A:
Q: DNA sequence
A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…
Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…
A: Polypeptides are the linera chain of Amino acids Synthesised according to the codons on mRNA.…
Q: If there are multiple start condo, how can you identify the real start codon? By observing Okazaki…
A: Transcription and translation are specialized events that are part of the central dogma i.e. DNA to…
Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…
A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG mRNA codon is ..…
Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…
A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…
Q: What is an Okazaki fragment, and how are they later “glued” together?
A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: Answer : glycine, proline, alanine, arginine, The possible codons can be CCG CGC GCC GGC GCG CGG
Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…
A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…
Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…
Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…
A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…
Q: 5' guanine cap 5' AUGCCGAUGCCUCCUAUCAGAUAAAAUAAA poly A tail AAAA 3' During DNA replication, a…
A: The mutation is the sudden and abrupt change in the structure and function of the chromosomes.
Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand.…
A: This is the DNA which ultimately decides what amino acid sequences are going to be added to form a…
Q: A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of…
A: Template DNA sequence - 5’-CGATTACTG-3’ After transcription the sequence - GCUAAUGAC Explanation -…
Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…
A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…
Q: The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1:…
A: BASIC INFORMATION TRANSCRIPTION It is responsible for the formation of hnRNA which has the codes…
Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…
A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…
Q: For the following five sequences, what is the consensus sequence? 5′–GGGAGCG–3′ 5′–GAGAGCG–3′…
A: Consensus sequences models are most used methods for sequencing base sequences. Consensus sequences…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…
Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…
A: The central dogma of life includes the following processes: Replication: In this process, the DNA…
Q: Which of the following is the consensus sequence of the Kozak sequence?. O 5'AGGAGGU 3' 0 5 ТАТААТ…
A: Please follow step 2 for detailed explanation.
Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…
A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…
Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5'…
A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to…
Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…
A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…
Q: Consider the mRNA sequence below. Assume that the following MRNA segment has been translated.…
A: Genetics is the branch of biology that deals with the study of genes, their variation, and heredity…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…
Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…
A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…
Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…
A: Note - We answer one question at a time. The set of rules through which information in the DNA or…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…
Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…
Q: Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for…
A: Translation is the process during which codons in mRNA are identified by tRNA with specific…
Q: For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’…
A: The translation is the process in which proteins are synthesized from the RNA. The ribosome and tRNA…
Q: For the case n = 5, the equilibrium constant for this reaction, Keg, is 5-10³ and for n= 6 Keg =…
A: Thermodynamics in biochemistry is the quantitative study of the change in energy which occurs in or…
Q: Diagram the likely secondary structure of an RNA with the sequence
A: The secondary structure of RNA is referred to as the folding of a single polynucleotide sequence of…
Q: n the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding…
A: There are two types of the strand, i.e., the coding strand and the template strand present in the…
Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…
Q: A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,…
A: A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,…
Q: What is the complementarity rule that governs the synthesis of an RNA molecule during transcription?…
A: Complementarity is a property according to which two DNA or RNA strands bind with each other or new…
Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…
A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…
Q: Determine the sequence of amino acids specified by the codons in the following information strand.…
A:
Q: The mature m-RNA is capped by which of the following heterocyclic bases (or which of the following…
A: Transcription is a process through DNA is converted into mRNA.
Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…
A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…
Step by step
Solved in 2 steps
- in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?Please by using the first base of each as the first triplet in a condo, how do I translate two almost identical RNA strand into sequences? You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
- For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?
- Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand. tRNA UAA CCA UUA UAA mRNA Amino Acids AUU = isoleucine AAU = asparginine GGU = glycine GUC = valine GAG = glutamic acidConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for letters a and b: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu a. Using the table of the genetic code, determine the sequence of amino acids. b. If mutation occurs by substitution of the 12th nucleotide with cytidine-5’-monophosphate, what is the resulting amino acid sequence? c. What type of mutation occurred? Choose from same sense, missense and non-sense.For the anticodon sequences 5' IAA and 5' xm^3s^2UAA, considering the DNA sequences of the genes encoding the tRNAs(assuming both tRNAs exist even if that is not true), What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? be sure to indicate polarities.
- In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?