sequence belo - Indicate the start site for translation by underlining the start codon. - Translate the sequence into the polypeptide sequence. Indicate the N-terminal end and C-terminal end of the new polypeptide. - Indicate the TRNA anticodons used to generate the polypeptide. Indicate the 5' and 3' of the tRNAs. 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…

Q: How many tRNA molecules can associate with a ribosome at any given time during translation

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: TRANSLATE this RNA sequence: AUGCAAUGA Met-Gin-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop What…

A: As you have posted multiple questions, we are supposed to answer only first 3 subparts. Kindly…

Q: The template strand of wild-type gene A is shown below. On the space provided, type the translation…

A: Amino acids are known as the building blocks of protein. They are required for the synthesis of…

Q: Look up a standard genetic code table, how many codons will be recognized by tRNA charged by…

A: Introduction A gene can be defined as sequence of bases that encodes a functional protein molecule.…

Q: describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be…

A: Usually Central dogma of Molecular Biology is followed during the process of protein synthesis which…

Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Second letter UUU Phenyl- UUC alarine UGU UGC Cysteine UAU UCU UCC UCA UCG UAC yrosine Serine UUA…

A: Mutation of amino acids change the primary structure of the protein which affects the protein…

Q: Please by using the first base of each as the first triplet in a condo, how do I translate two…

A: Translation Translation is the process in which the mRNA or messenger RNA is get translated. mRNA of…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: Noncoding Strand -> 5’ - G   C     C     A   G     G   T       C     A     G   G     T -   3’…

A: The terms used in the question represents the molecules involved in gene expression. A gene is a…

Q: Complete each of the following statements by selecting from the bank of terms below. a. tRNA b.…

A: 81)Redundancy 82)Universal  83)Elongation  84)Promotor 85)RNA processing  86)snRNA 87)tRNA

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: During initiation of translation, a                                  is positioned first at the…

A: The translation is the process of synthesis of proteins that occurs on the ribosomes in the…

Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…

A: DNA replication is the process by which a single DNA strand will produce two identical daughter…

Q: When examining the genetic code, it is apparent that ________.     there are 44 stop codons…

A: The process of polypeptide chain synthesis or protein synthesis is known as translation. By this…

Q: Consider the mRNA sequence below. Assume that the following MRNA segment has been translated.…

A: Genetics is the branch of biology that deals with the study of genes, their variation, and heredity…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A:

Q: Suppose the following peptide chain was attached to a gly -tRNA during translation : met -leu-asp…

A: Serine will be added next to glycine in the growing peptide chain through formation of a peptide…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…

A: Peptide formed from given mRNA sequences.

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The anticodon of the tRNA is 3'-UAC-5', and it binds to a codon in an mRNA with the sequence…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows,  TGC GTG TAC CTA CCA

Q: Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately…

A: The translation is the process of producing protein mRNA as a template and peptidyl activity of the…

Q: From the given DNA base sequence indicated below:…

A: The process by which the information contained in the DNA is converted to RNA is referred to as…

Q: Select all of the factors in the list below that play a role in the translation initiation of…

A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Methionine is used as the first amino acid for a particular polypeptide, but it is removed during…

A: The synthesis of proteins from the m RNA is called translation.

Q: Assume that the following mRNA segment has been translated.   5’-UACCGAAUGUCU-3’   Note for…

A: Translation is the process during which codons in mRNA are identified by tRNA with specific…

Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…

A: The translation is a process by which ribosomes in the endoplasmic reticulum synthesize proteins…

Q: Which amino acid would you expect a tRNA to be charged with if the TRNA has the anticodon 3' CUG 5'?…

A: Amino acids are biomolecules synthesized by the process of transcription and translation and form…

Q: The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation…

A: Virus are mostly pathogenic forms which neither considered to be living or non-living outside the…

Q: What is the importance of the anticodon on the tRNA?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…

Q: Using the table on the other page- transcribe the RNA sequence into codons and their amino acids:…

A: Given: Codons are given, have to tell which amino acid they code for. DNA => transcription =>…

Q: A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's…

A: RNA is Ribonucleic acid which is formed from DNA via the process of transcription . It takes place…

Q: In this picture, a tRNA is already bound to the initiator codon at the start of the mRNA strand. The…

A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…

Q: Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon…

A: tRNA is transfer RNA which is an adaptor molecule and assists in formation of peptide chain during…

Q: The following sequence is from the template strand of a bacterial gene, and it includes the…

A: According to the central dogma of the molecular theory, the information stored in DNA is first…

Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…

A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…

Q: Match each term with the most appropriate description. ​sites for polypeptide assembly   ​binds to…

A: All cells have the translation process resides within a specialized organelle which is known as the…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…

Spheres of physical activity

The spheres of physical activity experience include aspects of everyday life where physical activity is important. In general, the spheres recognize various purposes of physical activity in different contexts. The spheres of physical activity provide a broad basis for assessing the significance and prevalence of physical activity. There are seven spheres of physical activity experience.