Answered: 1. b. What is the sequence of the mRNA…

1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5' GAGCCAUGCAUUAUCUAGAUAGUAGGCUCUGAGAAUUUAUCUC 3' 2. a. From 1b, draw the structure of the peptide.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 29CTQ: A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that...

See similar textbooks

Related questions

Q: Explain the steps involved in phagocytosis. Why endocytosis found only in an animal cell? What is th...

A: Steps involved in Phagocytosis Target cell is attached to with the phagocyte using pseudopods. Targ...

Q: Repolarization occurs because Multiple Choice more sodium ions diffuse into the cell than potassium ...

A: At the resting stage, the Na+ and K+ channels remain closed.

Q: What are the typical features of the age pyramids of underdeveloped countries?

A: Introduction I'm this question we will discuss about the typical features of the age pyramids of und...

Q: 6.)Why is the human skull bigger than a monkey’s a.)To adapt to changing climate b.)To protect a lar...

A: There are some points related to above questions which should be kept in mind. These are as follows....

Q: Label the axons, dendrites, and soma of the nerve cell. Then, give a short description of this cell....

A: Nerve cell/Neuron It is an electrically excitable cell that processes and transmits information by ...

Q: Based on the information above, what can you speculate about the possible evolution of the genes tha...

A: Rab proteins are small GTP-binding proteins within a superfamily of GTPases known as the Ras superfa...

Q: Refer to problem 2. Determine the predicted genotype frequencies among the offspring of the followin...

A: Gregor Johann Mendel is usually defined as the way that they are been regarded as the father of gene...

Q: Why did Gregor Mendel choose pea plants as his experimental organism?

A: It was during the mid-nineteenth century thas headway was made in the understanding otl inheritance....

Q: What is the phenomenon of apical dominance in plants? How can it be artificially eliminated?

A: Introduction :- Apical dominance is a phenomenon in botany in which the plant's main, central stem i...

Q: A glass spreader can be sterilized by dipping in 70 % ethanol and burning of excess False .a True .b

A: Introduction:- Spreaders, also known as cell spreaders, are laboratory instruments that allow sample...

Q: Which is NOT a component of a Gram-positive bacterium's cell envelope? ○ peptidoglycan ○ N-acetylm...

A: Bacteria are classified according to their nature of cell wall into Gram positive and Gram negative ...

Q: How do populations of predators and prey vary in predatism

A: Introduction Whenever a predator population increases, the prey population tends to decrease at firs...

Q: In 1965, Jon Beckwith and Ethan Signer devised a method of obtaining specialized transducing phages ...

A: Introduction: An operon is a functioning unit of genomic DNA that contains These a genes group of ge...

Q: Cotegory: Inflammation Mechanism of vascular permeability includes all of the following EXCEPT:

A: Endothelial contraction renders spaces between adjacent endothelial cells and hence increases permea...

Q: Which temperature is Taq polymerase's optimal temperature O 20 degrees C 72 degrees C 55 degrees C O...

Q: . For several years, Hans Nachtsheim investigated an inherited anomaly of the white blood cells of r...

A: Genetics of disease: P allele = Pelger anomaly geneNallele = normal segmentationPP genotype = comple...

Q: Where do spindle fibers attach on a chromosome? O cell plate O meristem centromere

A: The chromosomes can be described as the thread like structures that can be found in the nucleus of t...

Q: Please list different types of glands and different purposes for them

A: Glands are of two kinds exocrine endocrine exocrine glands release their secretions directly into...

Q: Gel electrophoresis separates molecules based on size O charge O weight

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Ele...

Q: tabulate similiraties and differences of mitosis and meiosis

A: Introduction:- Mitosis and meiosis are the two ways that cells divide and reproduce. Meiosis produce...

Q: how does an organism maintains homeostasis through the interaction of the various organ systems in t...

A: Homeostasis, from the Greek words for "same" and "steady," refers to a self-regulating process by wh...

Q: NAD+ b. Pyruvate

A: Fermentation is a well stated to been supposed to define as is a metabolic process that involves the...

Q: Why is it important that in an aquatic environment, there are several receptors?

Q: How does a large amount of salt in the diet lead to an increase in blood pressure?

A: The force of blood pushing against the artery walls is referred to as blood pressure. Blood is pumpe...

Q: Describe stage 2 of the Calvin Cycle. Be sure to include the main molecules involved, and the main m...

A: The Calvin cycle is an important process utilised by all plants to get nutrition by converting the m...

Q: 1. Explain what "optimum" means. Do all enzymes have the same optimum pH and temperature?

A: Optimum means a state at which the best of a reaction or outcome occurs.And it is a level at which t...

Q: In sweet peas, the synthesis of purple anthocyanin pigment in the petals is controlled by two genes,...

A: In sweet peas, the synthesis of purple anthocyanin pigment in the petals is controlled by two genes,...

Q: What are persistent organic pollutants (РOPS)?

A: Introduction In this question we have to write about the persistent organic pollutants.

Q: Research has stated that there are factors that could affect the efficacy and duration of mosquito r...

A: There are many different types of mosquito repellants, but they all work to repel mosquitoes by mask...

Q: Consider two blood polymorphisms that humans have in addition to the ABO system. Two alleles LM and ...

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...

Q: in only one cell, label the nucleus, cytoplasm, and cell membrane for these two figures. Describe th...

A: 1. It is simple cuboidal epithelial cell , it is located at lines kidney tubules. Nucleus is presen...

Q: A gardener harvested 3,697 seeds from cross breeding a pure line red-flower petunia and pure line wh...

A: The characteristic that initially shows up or is shown in the organism is known as the dominant trai...

Q: You have a precursor protein that is translated in the cytosol with an N-terminal mitochondrial loca...

A: The mitochondria is a double membrane bound cell organelle that is responsible for energy (ATP) prod...

Q: In what ways are Leishmania and Trypanosoma similar with each other?

A: Leishmania is an intra cellular protozoan which is known to cause Leishmaniasis and Trypanosoma cruz...

Q: What is global warming? |

A: Introduction In this question we will discuss about the global warming in below steps.

Q: is the type of evolution when species shares a common ancestor but live in different places. a.) Con...

A: Introduction:- Homologous organs are those that have a common fundamental anatomical layout and embr...

Q: Cross the two brown frog with both heterozygous alleles on the two genes (BbGg x BbGg). 1. What is...

Q: In Figure 6-19,a. what do the square/triangular pegs and holesrepresent?b. is the suppressor mutatio...

A: Mutation is a permanent change in the genetic material (the genome) of a cell of a live creature or ...

Q: Make you own cladogram. Examine the characteristics of the animals listed on the table below and est...

A: A cladogram depicts the evolutionary links between different groupings of organisms. It's similar to...

Q: In your own words, kindly give the function and allowable limit (if applicable) of each of the follo...

A: All the given ingredients have their own health benefits. These ingredients are essential and have a...

Q: In a maternity ward, four babies become accidentallymixed up. The ABO types of the four babies are k...

A: Blood group is determined or governed by three alleles (as opposed to normally two alleles) in human...

Q: explain the significance of human nervous system in maintaining homeostasis.

A: Introduction: A complex system of nerve cells and fibres that receives and transmits signals from an...

Q: Provide two examples using the term “sex” and two examples using the term “gender”

A: The terms sex and gender are generally considered to be interchangeable; however, they can be differ...

Q: Which of the following is an example of viral species? a. Flavivirus O b. None of the choices human ...

A: Introduction : Viral species : " a monophyletic group of viruses whose properties can be disting...

Q: What are the main natural plant hormones and what are their respective effects?

A: Introduction In this question we have to write the main natural plant hormones

Q: Marfan Syndrome is a dominant trait inheritance in humans. It is a disorder that affects the connect...

A: Marfan syndrome is a genetically inherited disease which affects the connective tissue in the of bo...

Q: Considered less stable Whole blood is contained in a Green top tube Whole blood is contained in a Ti...

A: Plasma: Component of blood, pale yellow viscous fluid. Mainly constitute of albumin, globulin, immun...

Q: How is a phylogenetic “bootstrap value” calculated? Simplify and show the steps

A: Bootstrap value in phylogenetics is the value out of 100,which is the number of times the same branc...

Q: Differentiate between a genetic disorder and a geneticabnormality

A: Genetics is the study of genes. The expression of genes can affect the phenotype of an organism. Aff...

Q: Identify the steps involved in designing an experiment.

A: Experiments are conducted to test a particular hypothesis. Results then give a measure of how true o...

Question

1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends
5' GAGCCAUGCAUUAUCUAGAUAGUAGGCUCUGAGAAUUUAUCUC 3'
2. a. From 1b, draw the structure of the peptide.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
1. a)What are the two types of ncRNA used in translation? b.) How is translation terminated when the ribosome reaches a stop codon?
Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C. MRDMW-
1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon 5'AGG3'.
Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells? b)Provide an example of post-translational regulation of protein activity and explain the advantage of regulating each protein/process at the post-translational level instead of the transcriptional level.
: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?