4 3. 2 1 1 2 3 43 1 12 3 Deletion (a) 4 3 2 1 1 2 3 4 3 2 3 2 11 2 3 Duplication (b) 4|3 2 11 1 2 3 4 2 3 1 1 2 3 Inversion (C) 14 3 2 11 1 2 3 1 1 2 3 Simple 21 1 translocation 43 2 211 (d) J4 3 2 11 1 2 2 11 2 3 Reciprocal 21 1 translocation 43 2 11 (e)

Q: 5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the…

A: The amino acid chains are produced from the mRNA by the process of translation. In this translation…

Q: 3. What are the different kinds of gametes could the following individuals produce? Remember to use…

A: In Mendelian genetics, the crosses of two organisms become more and more complex as we choose the…

Q: 6.Rank order the following 10-base dsDNA sequences by "melting" temperature to single strandedness,…

A: In DNA there are four nucleotides, or bases, in DNA: adenine (A), cytosine (C), guanine (G), and…

Q: 5. A light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate…

A: A genome is a full set of genetic material found in an organism.  Deoxyribonucleic acid (DNA) is a…

Q: What would be the chromosome number of progeny resulting from the following crosses in wheat (see…

A: Genetics is the study of genes and their functions. Genes are the regions in the DNA that code for…

Q: In Figure 17-26, the bottom panel shows that genes B andC are oriented in a different direction…

A: Inversion has many effects on genes either it has no effect or disrupts the gene function. This…

Q: 5. Convert each of the following 3' to 5' DNA sequences to 5' to 3' DNA sequences. a. 3' ATCG 5' b.…

A: DNA contains all the genetic information of an organism in the form of genes. These genes are…

Q: %3D 16 12 %3D %3D 18 22 What is the name of this disorder? O There is not a disorder present O…

A: Down syndrome is condition in which an individual have extra copy of 21st chromosome  ( trisomy 21)…

Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…

A: The genetic material in most organism is double stranded DNA with the two strands running in…

Q: 00 PR 3. Which of the following is characteristic of reciprocal translocation? O a. Parts of two…

A: Given: A sudden change cause in a genetic material is called mutation.The mutation may occurs due to…

Q: What features of this pedigree indicate that the allele forDuchenne muscular dystrophy is X-linked?

A: Duchenne muscular dystrophy (DMD) is a severe genetic disorder. In this disease progressive muscle…

Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…

A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…

Q: 8. Phenylketonuria (PKU) is an inherited disease caused by a recessive allele. If a woman and her…

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: 17. A chromosome is found to be shorter than its homologous match. Which type of mutation would this…

A: Mutation can be described as a condition in genetics during which alternation occurs in an…

Q: Select the letter of the most appropriate answer.          -           A.           B.           C.…

A: Hello, thank you for your question. One section has 11 points and the other has 14 points. So if it…

Q: THE ROLE MOSOMES 1. Examine the chromosomes shown below from two people. Then, answer the questions…

A: Since there are multiple questions in this particular question, I'll answer the first three subparts…

Q: a)What is the complementary strand of TTGACAGTAAAA? b)List the possible genotypes for an individual…

A: a) Complementary strand has nucleotides AACTGTCATTTT Thymine (T) base pair with Adenine (A) with two…

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: 4. The bars in the following sequence indicate the breakpoints of a deletion.…

A: The given sequence has bars indicating the breakpoint of a deletion means we are going to delete the…

Q: 8. Circle the choice that best describes the statements or answers the questions below. Multiple…

A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…

Q: 6. Which of the following DNA sample composition is expected to have the highest boiling point? A.…

A: As per Chargaff's rule, number of guanine is equal to number of cytosine and amount of thymine is…

Q: Which of the following are the correct types of chromosomal mutation as shown from Figure 1.4? *…

A: Correct option is B i.e.  Inversion Insertion Deletion Translocation

Q: 28. What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′…

A:

Q: 08 Figure 1. Pedigree Key Key PART A Unaffected male OUnaffected female Figure 2. Family A Figure 3.…

A: Typically, at most one member of the family has a genetic condition, and analyzing the pedigree can…

Q: 5. A light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate…

A: A genome is a full set of genetic material found in an organism.  Deoxyribonucleic acid (DNA) is a…

Q: 1). What is the concentration of a solution of DNA with an OD260 of 0.3? ----I got 15 micrograms/mL…

A: Values given  OD 260 = 0.3 A260 of 1.0 = 50µg/ml pure dsDNA Concentration (µg/ml) = A260 reading ×…

Q: Define the following terms: a. single nucleotide polymorphism b. nonsense mutation c. indel d.…

A: Answer- Mutations are the changes in the DNA sequence that happen due to the exposure of mutagens…

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG

A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…

Q: Determine which primer pair is the best choice. • Explain why the other primers are not good…

A: A brief DNA or RNA sequence serves as the template and controls the production of a complementary…

Q: On the 4 diagrams below show the four different ways (which strands are cut and where for each…

A: In our daily life, many events have occurred in which DNA exposed to DNA damaging agents like…

Q: 10. Analyse the following DNA sequences and identify and explain the anomalies you observe. If there…

A: A nucleotide is the most fundamental component of nucleic acids (RNA and DNA). A sugar molecule…

Q: Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’   A. How…

A: A nucleotide consists of a sugar, a nitrogenous base and a phosphate group. A phosphodiester bond is…

Q: MULTIPLE CHOICE: Select the BEST ANSWER for each item by ENCIRCLING THE LETTER corresponding to the…

A: As per our guidelines, we are supposed to answer only three sub-parts. Kindly repost other question…

Q: 62 The lagging strand is indicated by c 3' 5' a 9. 5' d 3' C e f a 5' 3' 3' 5' Select an answer and…

A: DNA replication is the process by which new DNA is synthesized from the old DNA molecule by…

Q: 08 PART A Figure 1. Pedigree Key Key Figure 2. Family A Figure 3. Family B вто 1a 2a 1b 2b 3a 4a 5a…

A: Pedigree analysis A Pedigree analysis represents the inheritance pattern of a trait. It is used to…

Q: For a given cross, the expected number of double recombinants is 20 and the observed number of…

A: A double-crossover occurrence transfers the allele in the middle of one sister chromatid to another.

Q: 7. Table 1 contains data that Erwin Chargaff published about the composition of DNA. Table 1.…

A: The Chargaff rule states that there should be 1:1 stoichiometric ratio for purine( adenine and…

Q: 52. Which of the following base pairings is CORRECT?  Group of answer choices C-T A-C C-G A-G

A:

Q: A palindrome is a sequence that is read the same on both strands in the 5’—>3’ direction Question:…

A: A palindrome sequence is commonly used in biotechnology. It is the location of 6 or 7 or 8 base…

Q: Which of these changes in chromosome structure alter the total amount of genetic material?

A: Chromosomes may undergo rearrangements that are the mutations in the chromosomes that can alter the…

Q: Below are 9 possible primer pairs. • Determine which primer pair is the best choice. • Explain why…

A: Primers Primers are short nucleotide sequences (18-22bp long) used to synthesise a complementary…

Q: Question 36                  Nonhomologous end-joining (NHEJ) repairs DNA lesions that affect both…

A: Nonhomologous end-joining (NHEJ) repairs DNA lesions that affect both strands Answer: TRUE…

Q: 1. Give the Recombination Frequency of the following and show your solutions. a) Parents: AAbb x…

A:

Q: 46. 1 10 日 # Toko dedod Uesty A. Cri du chat syndrome B. chromosome 5p deletion syndrome C.5p minus…

A: Different chromosomal aberrations and gene mutations are responsible for producing different…

Q: 6. Which of the following DNA sample composition is expected to have the highest boiling point? A.…

A: Since you have asked multiple questions we will answer the first question for you. If you want any…

Q: MUTATIONS Match the words with their definition. 1. Mutation 2. Mitosis 3. Crossing Over 4. Mutagen…

A: Introduction Mutation:- It occurs when a DNA gene is damaged or changed in such a way as to alter…

Q: SMC proteins facilitate the structural maintenance of chromosomes; describe the roles of the two…

A: SMC is abbrebiated form of Structural Maintenance of Chromosomes. SMC complexes are large family of…

Q: 5. A light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate…

A: A genome is a full set of genetic material found in an organism.  Deoxyribonucleic acid (DNA) is a…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.