4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidence

4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidence

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 4CT: The photos above show flowers from Arabidopsis plants. One plant is wild-type (unmutated); the other...

See similar textbooks

Similar questions

1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
Bt toxin is considered to be. a gene for modifying insect DNA an organic insecticide produced by bacteria useful for humans to fight against insects a recombinant protein
The photos above show flowers from Arabidopsis plants. One plant is wild-type (unmutated); the other carries a mutation in one of its ABC floral identity genes. This mutation causes sepals and petals to form instead of stamens and carpels. Refer to Figure 10.8 to decide which gene (A, B, or C) has been inactivated by the mutation.
1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also charged methionine tRNAs with alanine? b)What would happen if an individual was homozygous for mutant alleles of the gene encoding the aminoacyl tRNA synthetase responsible for charging leucine tRNAs?
8. As explained in the text, the cause of many geneticdiseases cannot yet be discerned by analyzing wholeexome/genome sequences. But in some of theseseemingly intractable cases, important clues can beobtained by looking at mRNAs or proteins, ratherthan at the DNA.a. As you will see in more detail in later chapters, it ispossible to use single-molecule methods to sequence cDNA copies of millions of mRNA molecules from any particular tissue cheaply. Howcould you sometimes use such information to finda disease gene? When would this information benoninformative?b. A technique called Western blotting allows you toexamine any protein for which you have an antibody; it is possible to see differences in size oramount of that protein. How could you sometimesuse such information to find a disease gene? Whenwould this information be noninformative?
I still do not understand why the number of coding regions are 6 based on the R-loop.
1. What can you conclude about the base composition and base distribution of G-C base pairs in the bandicootgenomic DNA from this result? Briefly explain how or why you would reach those conclusions.
1. What proportion in the human genome are actual genes? 2. What are tandem repeats?
Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…
5. A haplotype is a specific set of SNPs and other genetic variants observed on a single chromosome or part of a chromosome, as compared between individuals in a population. Shown below are eight DNA sequences from different individuals: Nucleotide Position 1 5 10 15 Sequence 1. TCTGGAT CAT CACAT Sequence 2. ACAGCAT CATIA CGT Sequence 3. TCAGGAT CATIA CAT. Sequence 4. TCAGGAT CATI A CAT. Sequence 5. ACAGCATCATI ACGT Sequence 6. TCT G GAT CAT CACAT Sequence 7. TCAGGAT CATI A CAT. Luis Pagoada Sequence 8. ACAGCAT CAT IACGT. a. Give the nucleotide positions of all single nucleotide polymorphisms (SNPs; nucleotide positions where individuals vary in which base is present) in these sequences. b. How many different haplotypes (sets of linked variants) are found in these eight sequences?
1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
4. Some transposases use extensive DNA replication to leave one copy of the element behind in a process called ____________________.A. persistent transpositionB. chronic transpositionC. exchange transpositionD. replicative transpositionE. none of the above 5. Which of the following is not an example of a transposable element found in bacteria?A. Tn5B. Tn10C. IS1D. IS903E. Xis 6. Besides a transposase, many common composite transposons in bacteria encode genes for:A. Toxin productionB. Antibiotic resistanceC. DNA repairD. Homologous recombinationE. None of the above