9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X. Underline your primers, and also write each of their sequences 5’ →3'. There is no really right answer, but there are lots of wrong ones. Hint: make sure each primer is going in the right direction, and is on the correct strand. 5'atgaccatgattacgaattcgagctcggtacccggggat 3'tactggtactaatgcttaagctcgagccatgggccccta ctgcaggcatgcaagcttggcactggccgtcgttttacaacg gacgtccgtacgttcgaaccgtgaccggcagcaaaatgttgc Gene X
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
Primer1: seq1 atatatatccccccatcactgggggg
Primer 2: seq2 tatatactagggtacgtatgcccccc
Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA sequence within a heterogenous collection of DNA sequences e.g., total genomic DNA or a complex cDNA population. The technique was developed by Kary Mullis, in 1985.To carry out the amplification, some prior information on the DNA sequence is required, based upon which two oligonucleotide primers (usually 15-25 nucleotides long) which are specific for the target sequence is designed. After the primers are added to the denatured template DNA, they bind specifically to complementary DNA sequences at the target site. In the presence of a suitably heat-stable DNA polymerase (eg. Taq polymerase) and the four deoxy nucleoside triphosphates (dATP,aGTP,dCTP,dTTP), primer initiates the synthesis of new DNA strands which are complementary to the individual DNA strands of the target DNA segment.
Step by step
Solved in 2 steps with 1 images
