4. In a given population of 1000 individuals, the allele frequencies are a = 0.4 and A = 0.6. What would be the expected genotype frequencies if this population was at HWE? How many individuals would have each genotype? (p2 + 2pq+q2 = 1).

4. In a given population of 1000 individuals, the allele frequencies are a = 0.4 and A = 0.6. What would be the expected genotype frequencies if this population was at HWE? How many individuals would have each genotype? (p2 + 2pq+q2 = 1).

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter19: The Evolution Of Populations

Section: Chapter Questions

Problem 8RQ: When male lions reach sexual maturity, they leave their group in search of a new pride. This can...

See similar textbooks

Related questions

Q: When is gelatin used in culture media preparation?

A: Gelatin is a protein with a consistent molecular structure that is mostly produced by the…

Q: All of the following proteins function during nucleotide excision repair, EXCEPT: A. DNA pol B. Uvr…

A: INTRODUCTION • Nucleotide excision repair (NER) is a particularly important excision mechanism that…

Q: All of the following regarding ribosomes are true EXCEPT: A. Ribosomes are comprised of protein and…

A: The answer is option c. All of the following regarding ribosomes are true EXCEPT ribosomes bind…

Q: What is reproduction

A: Introduction All living organisms shows some basic features which distinguish them with non-living…

Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…

A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…

Q: Give an example of an anaerobic traning exercise program using the FITT Principle

A: FITT PRINCIPLE: It is a method to create a perfect workout plan. It is presented with a structure…

Q: Melvin, ace biology student, is making a display for Ms. Fishhawk's class to show what "isotonic,"…

A: The movement of molecules across a biological membrane (semipermeable membrane) depends on there…

Q: Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker…

A: DNA is the genetic material in most living organisms.

Q: You are studying a newly discovered gene, whose alleles code for one of two phenotypes, either…

A: Inheritance pattern is a type of pattern which determines how traits are passed on from parental…

Q: In 1988, neurologists in Australia reported the existence of identical twins who had developed…

A: Myoclonic epilepsy is a type of epilepsy that is characterized by myoclonic seizures. Myoclonic…

Q: etermine the responsiveness of the wild-type protein to maltose, the way by which mutation affects…

A: Prior to the reporter gene transformation, the lacZ - bacteria were mutagenized. The altered…

Q: Whare are five general reasons why scientists conduct surveys

A: A Survey is a study of behaviors, opinions, and needs of a particular group of people. In a survey,…

Q: This is an image of a lily flower. Based on your reading, please click the part of the flower where…

A: Sexually reproducing organisms produce male and female gametes. The fusion of male and female…

Q: Regarding the analysis of single marker STR results used in forensic science. Tick all the correct…

A: Short Tandem Repeats (STR) are the specific location in chromosomes used for forensic analysis. In…

Q: Some of the characteristics of a scientific observation are that it: I.is directed at proving or…

A: Introduction The scientific method of observation. A scientific study involves the following steps-…

Q: Explain the entire process of DNA replication.

A: Introduction : The biological process of producing two identical copies of DNA from a single…

Q: Suppose a new mutation arises in a mitochondrial genome. Explain what would have to happen in order…

A: Mitochondria is a double membrain bound cell organelle found in eukaryotic cells. It contain double…

Q: Melvin, ace biology student, is m hypertonic" and "hypotonic" mean. Melv nembrane. The figure shows…

A: Hypertonic hypotonic and isotonic solutions are solutions which refers to the tonicity or a measure…

Q: What is the name of the inverted mini tube inside the larger test tube? Simmons tube Malachite tube…

A: Test tubes These are pieces of laboratory glassware that have finger-like length of glasshold and…

Q: Provide a diagram of the EPH RECEPTOR B2 (EPHB2) structure. Give bioinformatics structure

A: Ephrin-B2 is a powerful regulator of endothelial cell activity, implying that ephrins influence cell…

Q: 2.(3 pts) A normal red blood cell is small and shaped like a flattened disk. The interior of a red…

A: Introduction : Osmosis is the movement of water molecules passing from a less concentrated solution…

Q: Provide 2 examples of Diffusion, Osmosis, and Semi-Permeable Membrane (1 from the "Diffusion Through…

A: Diffusion and osmosis are quite similar which describes movement of substance from its a region of…

Q: THIS IS BABY's CORD BLOOD SAMPLE. The letters on the cell represent BABY's RBC antigens, those…

A: The ABO blood group system is used to denote the presence of one, both, or neither of the A and B…

Q: Which of the following is UNTRUE with regards to human gametes and their production: A. Female…

A: A. Female gametes complete Meiosis II only after fertilization - true Explanation - Oogenesis• Each…

Q: Use the Hill Equation to determine the fractional saturation of hemoglobin in equilibrium with blood…

A: The phrase "fractional saturation" relates to the FO2 Hb, that is the portion of total haemoglobin…

Q: 1. Why is an increase in thirst and urine output associated with diabetes? 2. What is a healthy…

A: The blood glucose level is a measure of the amount of glucose in the blood. The normal range for…

Q: During capillary exchange, which of the following occurs only at the arterial end of a capillary?

A: Introduction Capillaries are extremely narrow (less than 1 mm long), microscopic tube with one cell…

Q: 10) A a base and a sugar. A) nucleoside B) base pair C) nucleotide D) complementary base E)…

A: According to bartleby policy we have to answer only first three multiple choice question hence…

Q: What is the description of the growth and growth pattern of the microorganisms in the spread plate…

A: In the spread plate method, the growth of microorganisms is determined by the number of colonies…

Q: Through which tissue do sugars get transported to reach the leaves during growth and reproduction?

A: Introduction Plants are the immotile organisms, which live on soil and water. They prepare there…

Q: ) A moose is an example of an organism that is large, lives relatively long, and has long generation…

A: Limiting elements in the natural environment, such as access to food, water, shelter, and space, can…

Q: How many different DNA sequences could code for amino acid sequence Met-His-Leu-Thr-Trp-Lys? (Note:…

A: DNA is a hereditary molecule. It carries the genetic information that is passed from one generation…

Q: Why are coal and natural gas fuels considered no renewable?

A: Non-renewable energy is a form of fuel or power which cannot be replenished; as a result, its…

Q: Give an example of an aerobic traning exercise program using the FITT Principle

A: A helpful tool for tracking daily workout regimen is the FITT Principle. The letter F indicates…

Q: What weed is a perennial broad leaf weed

A: Perennial broad-leaf weeds are those broad-leaf weeds that complete the life cycle in more than two…

Q: Nutrition Labels: Analyze the nutrition label attached and answer the following questions: How…

A: INTRODUCTION Fats Fat also called fatty acid or lipid. It is made up of carbon hydrogen and oxygen.

Q: During excitatory synaptic transmission, the electrical signal carried along the axon of a…

A: The point of electric nerve impulse transmission between two nerve cells (neurons), or between a…

Q: In this cartoon, imagine that Romeo is a potassium ion (K+) and Juliet is a sodium ion (Na+).…

A: The plasma membrane of the cell regulates the entry and exit of different molecules according to…

Q: Describe the steps including the roll of ion terminals in a neuronal action potential

A: An action potential is created when the voltage difference between the inside and outside of a…

Q: What advantage(s) if any, do flower clusters have over that of single flowers?

A: Flowers are the reproductive structure that are very important in case of sexual reproduction.…

Q: Mrs. Scott, a 28-year-old year teacher, schedules an appointment complaining of persistent…

A: Thyroid gland is an important endocrine gland which secrets thyroxine hormones into the blood Size…

Q: Is each of these statements true of chloroplast or mitochondrial genomes, both, or neither?…

A: Instructions for making the molecules known as tRNAs are provided by the genes in the tRNAs…

Q: this is an example of biotechnology: In order to increase the yield of oil from canola, research…

A: Biotechnology is the branch of science that deals with the production of various products by using…

Q: how is scanning electron microscopy unique and usefulm what makes this so important?

A: Electron microscopes use a focused beam of electrons to image the specimen while optical microscopes…

Q: When making bread with common yeast, the reaction starts as an aerobic process and then becomes an…

A: The bubbles obtained in the bread is the result of the formation and collection of gases such as…

Q: 22) What is the process in which the DNA double helix unfolds, and each strand serves as a template…

Q: With the help of well labelled diagram describe the structure of a archaeal cell.

A: Archaea is a prokaryotic domain that are present throughout the biosphere. Many genera are…

Q: Food-borne pathogens are most commonly identified by _________. pulsed-field gel…

A: Food-borne pathogens the bacteria that contaminate food and produce disease by these bacteria are…

Q: Social inequality, violence, warfare, disease, overpopulation, environmental degradation, lower…

A: Until the advent of agriculture about 10,000 years ago, humans were hunter gatherers. Food supplies…

Q: A raw wastewater is chlorinated before discharging into the environment. Due to potentially high…

A: The MPN is the most probable number. This is the test used to identify the most probable number of…

Question

Question is in the image. Please show your work. Thank you so much!

4. In a given population of 1000 individuals, the allele frequencies are a = 0.4 and A = 0.6. What
would be the expected genotype frequencies if this population was at HWE? How many
individuals would have each genotype? (p2 + 2pq+q2 = 1).
allales of gene A exist A and a. Gene A DNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If a population of skunks includes some individuals with stripes and others with spots, would you describe the variation as quantitative or qualitative?
Population genetics is the study of: how selective forces change the allele frequencies in a population over time the genetic basis of population-wide traits whether traits have a genetic basis the degree of inbreeding in a population
When male lions reach sexual maturity, they leave their group in search of a new pride. This can alter the allele frequencies of the population through which of the following mechanisms? natural selection genetic drift gene flow random mating
1. A sample of 600 individuals from a population is examined for the presence of the HindIII polymorphism in an autsomal Sca gene. There are two alleles of Sca gene, A and a. The results are 14 individuals are AA, 212 are Aa, 374 are aa. Please answer the following questions accordingly? How many alleles are present in the gene pool in the sample population fort he Sca gene? What are the genotype frequencies? What are the frequencies of A and a alleles? What are the expected numbers of the three genotypes, assuming random
4) Which of the following does not alter allele frequencies? a.Inbreeding b.Gene flow c.Genetic drift d.The bottleneck effect e.Natural selection
1.)The frequency of the R allele for round seeds in a certain population of 500 peas wasfound to be 0.45. How many of them were wrinkled? How many of them had the rr genotype? How many of them were round? 2.)In humans, a dominant allele controls the formation of a cleft chin, a Y-shaped fissurein the chin caused by an atypical bone formation in the mandible (this phenotypeis also known as a chin dimple). A survey of 1200 college students found that108 of them did not have a cleft chin. What was the frequency of heterozygotes inthat student population?
1. What is the expected time to fixation in generations for a new mutation in a diploid population (like humans) with an effective population size of 50? This new mutation is neutral and has no impact on fitness (e.g. synonymous polymorphism). Assuming the mutation isn’t lost immediately, will it reach fixation faster in a population of Ne=500 or Ne=5,000 and why?
2. You have sampled a population in which you know that the percentage of the homozygous recessive genotype (a) is 26%. Using that 26%, calculate the following: A. The frequency of the "aa" genotype. B. The frequency of the "a" allele. C. The frequency of the "A" allele. D. The frequencies of the genotypes "AA" and "Aa." E. The frequencies of the two possible phenotypes if "A" is completely dominant over "a
1) Genetic drift is the result of ______. A) differential reproductive success B) chanceC) a large gene pool D) natural selectionE) environmental variation Then explain why every incorrect answer is wrong and why.
1. Based on the class data from Experiment I, for each of the three populations, describethe effect of population size on genetic diversity over time. Your answer should touchon the magnitude of any genetic changes through time for each of the three populationsizes.
1. Which among the following is NOT a principle of natural selection? a. The DNA sequence of the organism will change. b. The characteristics of organisms are inherited or passed from parent to offspring. c. Offspring vary among each other about their characteristics, and those variations are inherited. d. More offspring are produced than can survive. 2. Tawilis is a freshwater sardine endemic only in the Taal Lake in Batangas province. After several eruptions of the Taal volcano in the 21st century, the sardine population mentioned above rapidly dropped up to 82%. What best describe this scenario? a. mutation b. migration c. natural selection d. genetic drift
1) What does the term Natural Selection mean? Select one: a.The number and relative frequency of alleles present in a particular population. b.The process through which individuals with certain traits tend to produce more surviving offspring that individuals without those traits. c. Any change in the hereditary material of an organism.