Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker Carol to be messengers, while their boss can't leave the nucleus.
Q: 82 81 83 80 O 79 78 75 76 77
A: Leeches have segmentation, they are parasitic or predator insects which belong to the order…
Q: How is it possible for a bacterium to grow in a hypertonic environment?
A: A hypertonic environment is an environment where the external surrounding media have a higher…
Q: When ethanol binds to glutamate receptors it operates as a receptor ______________________ and…
A: Introduction : A chemical that mimics the behaviour of another drug and triggers an action os known…
Q: In etanol determination by specrophotometry, explain the purpose of the negative controls included…
A: Ethanol can be produced chemically or biologically by chemical reactions or petro-chemical processes…
Q: 53. Which of the following is a genetic disorder caused by a mutation in only a single nucleotide…
A: Sickle cell anemia - It is a genetic disorder that causes red blood cells to become sickle shaped…
Q: Bacterial transformation and bacteriophage labeling experiments proved that DNA was the hereditary…
A: Introduction: With the exception of certain viruses, all organisms have DNA as their genetic…
Q: 4. Cancer cells keep proliferation and eventually kills the host (human body). Unfortunately, you…
A: Cancer is a condition when a few of the body's cells proliferate out of order and migrate to other…
Q: 18) UV radiation damages DNA by causing... a) frame-shift mutations b) base substitutions c) bonds…
A: Introduction Genetic variation is very important for evolution, but genetic stability is crucial for…
Q: Which statement best describes the interaction that occurs as a result of the bindi ligand to a…
A: Option- B
Q: in 1995, a population of 31 gray wolves was introduced into Yellowstone National Park. The…
A: Some species live in unique climatic conditions since every living thing developed to exist in a…
Q: Catalase Result bacitracin on blood agar B
A: Introduction : A prokaryotic organism with only single cell is a bacteria. They lack a nucleus and…
Q: 16- A population's carrying capacity ____. a- increases as per capita growth rate (r) decreases…
A: The collection of all the individuals of same species in a particular area that interact with each…
Q: The mouse scurried across the floor although the cat seemed uninterested.
A: The writing sentences are of different types. The variety of sentence structure is written so as to…
Q: Explain in detail the importance of experiment by Ernst Chain and Norman heatley
A: The pathogenic germs are usually stated that they are been known as they are invading are killed or…
Q: Is the removal of large portions of the bark of trees known for their medicinal value beneficial or…
A: The functionality or structure of plants is the subject of the botany subdiscipline known as plant…
Q: explain the advanatges and disadvanatges of the importance of inflammatory response genes in CIN,…
A: It is believed that COX-2 plays a significant part in the development of colorectal malignancies.…
Q: In a variety of tomato plant ,the leaves maybe pure green,pure white,or variegated (mixture). a)when…
A: The purebred is the crossing of two individuals with the genotype with the same alleles for a gene…
Q: 1. Why flowers develop into clusters? What its taxonomic significance?
A: Flowers are the modification of shoot having limited growth. Flower acts as reproductive organ of…
Q: What was the biochemical reason for the "Ox Phos War," i.e., why was Peter Mitchell's hypothesis…
A: The Chemiosmotic Theory was first proposed by Peter Mitchell in 1961. It is the process by which ATP…
Q: List at least three features of eukaryotic genomes that are not found in bacterial genome.
A: Introduction: In eukaryotic and prokaryotic cells, the DNA has a different structure and chemical…
Q: If a mouse has a dominant phenotype (P_), how would you determine if it is homozygous (PP) or…
A: Each gene coding for a specific trait has two alternative forms called alleles. These alleles can be…
Q: The risk of Cancer increases as body mass increases. Determining right and wrong
A: Cancer: The uneven multiplication of cells inside the body which can, later on, evade the…
Q: D. Write the pathway energy would take beginning with a photon striking PSII. Where does this energy…
A: Plants and other living things having chloroplast (algae) employ a process called photosynthesis to…
Q: chromosome
A: Chromosomes: These are threadlike structures made up of protein and a single DNA molecule which…
Q: 8. Observe the sex-linked pedigree provided here that is tracking the red-green color- blindness…
A:
Q: What purpose does paragraph 8 serve in the text? A. It explains additional factors identified by…
A: simulation models is used to represent or create a process that help to solve real world problem…
Q: A gene codes for I J. complementary base pairs on DNA molecules. K. an RNA molecule. L. sequences of…
A: DNA (deoxyribonucleic acid) is two stranded, helical, ladder like structure that functions as…
Q: Explain the kidney's role in water conservation. How much water is reabsorbed (by following other…
A: Kidneys role in water conservation. Nephron is the basic structural and functional unit of the…
Q: Below is the DNA sequence of a gene, what is the protein sequence?…
A: Proteins are biomolecules composed of monomers called "amino acids" that are adjoined by per tidal…
Q: Genes encoding toxins are often located on plasmids. A recent outbreak has just occurred in which a…
A: The plasmids are little circular DNA pieces that are distinct from chromosomal DNA. They are mainly…
Q: According to the text and figure 2, which statement accurately describes relationships among…
A: According to Figure 2,
Q: The mammalian immune response includes both innate-response mechanisms and adap- tive-response…
A: Introduction Innate immunity is the non specific type of defense, which develops quickly and…
Q: What elements among CHNOPS make up DNA and RNA?
A: Biopolymers and macromolecules called nucleic acids are necessary for all known forms of life. They…
Q: What is hormonal coordination
A: Introduction All multicellular organisms need to have control and coordination between the different…
Q: In an essay form describe how. Nitrogen in ground nuts can be found in the urea
A: A mechanism, whether natural or artificial, that enables free nitrogen (N2), a generally innocuous…
Q: Which of the following best describes a way in which a normal growth factor can stimulate cell…
A: A growth factor is a naturally occurring molecule that can promote cell growth, wound healing, and…
Q: We know that human blood type is determined by a three-allele system at a single locus. For the…
A: An person's genotype determines his or her phenotype. The alleles a person inherits from their…
Q: Desribe how the reproductive structures of each organism are adapted towards the given…
A: Even among different lineages, many animals share very similar reproductive structures. It's a cycle…
Q: 18 14 15 19 16 17 6 8 Figure 1 Nereis parapodium whole mount Figure 2 Nereis cross section.…
A: Nereis is a genus of the worm under the family Nereididae. Its the type of polychaete worm. They use…
Q: hich one of the following combinations of the organisation of cells, tissues and organs is rrect? I…
A: Cells are the building blocks of all living things. Amoebas and other single-celled organisms are…
Q: Cystic fibrosis is a degenerative disease that causes the progressive breakdown of the myelin…
A: Introduction Cystic fibrosis (CF) is a genetic disease that affects the lungs, digestive system, and…
Q: ESC (Embryonic Stem Cell) has ability to proliferate and differentiate into various cell types.…
A: Embryonic Stem Cell - The core cell mass of a blastocyst, an initial phase pre-implantation embryo,…
Q: When a neuron responds to a particular neurotransmitter by opening gated ion channels, the…
A: Neurotransmitter is a chemical substance released by neurons to communicate with the target cells or…
Q: You have become good friends with a fellow student in your organic chemistry class. They are a…
A: The spinal cord is the main tube at the back side of the body which carries the various nerve…
Q: In what type of species interaction are both species negatively effected. Briefly describe an…
A: In a natural habitat, the co-inhabiting organisms interact with one another to exert their…
Q: In a world of advancing technologies and innovative health care, some individuals would rather rely…
A: Gene therapy is an experimental technique in which genes are used to treat or prevent diseases or…
Q: What is it? tRNA Met 0- ✓ Formylmethionine Met-tRNA O- Aminoacyl-tRNA L-histidine Methionine H₂ NH₂…
A: Transfer RNA serves as a physical connection between the amino acid sequences of mRNA and…
Q: A phenotype reflecting a new combination of genes occurring during gamete formation is called
A: General, homologous, and site-specific genetic recombination fall under two categories. In…
Q: How can a scientist determine whether a protein with a common origin in bacteria and a fruit fly…
A: Introduction: Generally, proteins with similar sequences perform similarly. The same origin or…
Q: Plate LB-Plasmid LB + Plasmid LB/amp - Plasmid Yes Yes No + LB LB/amp + Plasmid Yes LB Prediction…
A: In the above experimental design there are four plates. +LB/AMP is a LB agar plate having ampicillin…
Step by step
Solved in 2 steps
- DNAT A C C A C C C C C G T A T G G C T G G G A A T A T C mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:DNAT A C C G C C C C A T G A T G A A T A C C G G G A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
- Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNACoding strand CGT CTC TTC GGA CAC whar is the mRna strandWhat does it define- defining theprocess of transcription- DNA to RNA The code is nonoverlapping
- Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the mRNA strand synthesized from this DNA?DNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______Define replication, transcription, and translation. In what part of the cell does each process occur?
- What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'