4e. You also study the expression of 3 different mutants for this gene. For each mutant answer thefollowing:Does this mutation change the sequence of the protein produced? Why or why not?If it does change the sequence of protein be sure to write out the new sequence.If it does not change the protein sequence, what effect (if any) would you expect itto have on expression of the gene?120ORI40605..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3'3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5'*promoteri. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair atposition 35 (position denoted by the * in the sequence above).ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ inthe sequence above).

[Note: Although the question mentions 3 mutants, only two were given. So, we will answer for the two…

4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'.TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTAT...3’ 3'...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5’ promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).

4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'.TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTAT...3’ 3'...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5’ promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 4TYK

See similar textbooks

Similar questions

4. Which or which (can select more than one alternative) of the control methods of genetic expression in eukaryotes NOT USED in prokaryotic cells?to. control how often a gene is expressedb. control how an mRNA is processedc. control which mRNA is exported from the nucleus to the cytosold. control which mRNA is translated to proteins in the ribosomeand. control how quickly proteins are destroyed once synthesized 5. Unlike DNA that usually forms a helical structure, different RNA molecules assume bends in a wide variety of 3D shapes. This is due to :to. RNA contains uracil and ribose as sugarb. the bases in the RNA cannot form hydrogen bonds with each otherc. nucleotides in RNA have a different chemical structure than they have in DNAd. Although RNA is single-stranded, complementary bases can pair with each other. 6. Viruses consist of a layer of protein that surrounds your genetic material. the genetic material in the HIV virus is:to. Double-stranded DNA (dsDNA)b. Single-stranded DNA…
Please answer both questions. 1. Can the compound cause expression for each gene. 2. Can cycloheximide affect expression of the gene if they were affected from the compound? Does this tell us something about expression of gene?
Researchers have successfully used gene therapy toameliorate some human genetic diseases by adding anormal gene copy to cells whose genomes originallyhad only nonfunctional mutant copies of that gene.For example, a form of blindness due to the lack of asingle protein called RPE65 has been reversed byintroduction of a normal RPE65 gene to cells of theretina of adults.a. The success of this gene therapy approach providesus with clues about the role of the RPE65 proteinin the retina. Do you think that RPE65 is neededfor the proper development of the human eye?b. Can you see a potential difficulty in applying this genetherapy approach for diseases like microcephaly?
Control of gene expression in eukaryotic cells occurs at which level(s)? only the transcriptional level epigenetic and transcriptional levels epigenetic, transcriptional, and translational levels epigenetic, transcriptional, posttranscriptional, translational and posttranslational levels
A scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal promoter elements encompasses 70bp. Gene B’s core promoter plus proximal promoter elements encompasses 250bp. Which of the scientist’s hypotheses is most likely to be correct? More transcripts will be made from Gene B Transcription of Gene A involves fewer transcription factors Enhancers control Gene B’s transcription Transcription of Gene A is more controlled than transcription of Gene B.
Mechanisms that govern gene expression do not operate during ___ . a. transcription b. RNA processing c. translation d. knockouts
How does the regulation of gene expression support continued evolution of more complex organisms? Cells can become specialized within a multicellular organism Organisms can conserve energy and resources Cells grow larger to accommodate protein production Both A and B.
Control of gene expression in eukaryotic cells occurs at which level(s)? a. only the transcriptional level b. epigenetic and transcriptional levels c. epigenetic, transcriptional, and translational levels d. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels
1. Contrast positive versus negative regulation of gene expression. Describe the role of the repressor in an inducible system and in a repressible system.
Many genes whose expression is turned on by DNAdamage have been isolated. Loss-of-function mutations in the lexA gene lead to the expression of manyof these genes, even when there has been no DNAdamage. Would you hypothesize that LexA protein isa positive or a negative regulator? Why?
1.Your goal is to design a strategy to create thisfinal pDHFR plasmid for fusion protein expressionfrom the materials available:You have an empty pET21a expression vector and another vectorthat contains the fusion protein nucleotide sequence (pBluescript + GST-DHFR-His). (#) indicatesbp location ofenzyme cut: a.EcoRIonly, HindIII only, NotIonly, EcoRI and HindIII, EcoRI and NotI, or HindIII and NotI? b.Briefly explain the rationale for your selection. Please connect your rationale to the need for compatible ends without any further manipulation and required directionality of the DHFR fusion protein coding sequence relative to the T7 promoter that will drive its expression. c.What is the final size(kb)of your desired pDHFR plasmid ligation product based onyour design? d. Complete the chart providedto indicate thesize of all fragments(in bp)resultingfrom complete digestion of each plasmid givenyour strategy, andthe fragment(in kb)from each you would isolate for ligation.Please mind…
4. Assuming the translation product is an enzyme, explain its role in the final expression of a phenotype.