5. Assume that you are trying to do a gel mobility shift experiment using a normal set of Trp genes. Lane i has just a DNA fragment containing the tryptophan promoter and operator sequences. Lane 2 has the same fragment along with normal (functional) TrpR protein. Lane 3 has the same fragment, normal TrpR protein, and tryptophan. Which electrophoretic pattern is correct for this experiment?

5. Assume that you are trying to do a gel mobility shift experiment using a normal set of Trp genes. Lane i has just a DNA fragment containing the tryptophan promoter and operator sequences. Lane 2 has the same fragment along with normal (functional) TrpR protein. Lane 3 has the same fragment, normal TrpR protein, and tryptophan. Which electrophoretic pattern is correct for this experiment?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

35) A researcher inserted DNA fragments from an organism into expression vector plasmids and introduced the modified plasmids into bacterial cells. Which of the following methods would be an effective means of identifying which clones contain a specific gene of interest?
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
32. All of the following are functions of introns EXCEPT A. Provide buffering capacity against mutations B. Allow shuffling of exons to make new genes C.Allow for alternative splicing, which allows a single gene to encode multiple proteins D. Allow for alternative splicing, which allows multiple genes to encode a single protein
30) In the CRISPR system, the targeted DNA sequence is
45. A mutation in the Duchenne muscular dystrophy gene involves the deletion of two bases and their replacement by two new bases. The deletion is shown below. AAG ↻Deleted bases The deleted bases are replaced by two guanine bases.The transcription of the mutated Duchenne muscular dystrophy gene described above results in the replacement of a Select one: a. lysine codon with a serine codon b. phenylalanine codon with a serine codon c. phenylalanine codon with an arginine codon d. lysine codon with an arginine codon
33. For the following gene, which type of regulatory sequence has likely been deleted in mutant 1?
Identify the type of point mutation on the following strands (transition or transversion): a. 5’ TACTGCA 3’ 5’ TATTGCA 3’ 3’ ATGACGT 5’ 3’ ATAACGT 5’ b. 5’ CGACGTTA 3’ 5’ CGAGGTTA 3’ 3’ GCTGCAAT 5’ 3’ GCTCCAAT 5’c. Which of these types is more common and why?
1. Methods of gene therapy 2. Explain Small RNAs and long non coding RNA. 3.what is name of the technique that would help a person who inherited LFS to have a child without the defective allele? 4 .Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.) 5. If Dr. Aikenhed wanted to see if there was mutation within the protein-coding sequence of the gene implicated in this disorder (as opposed to mutations afecting regulatory elements), what technique involving dideoxynucleotides could be used? Briefy describe this technique.
1. This complex assembles and organizes nucleosomes and contributes to gene repression Group of answer choices a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 2. A DNA lesion occurring when the deoxyribose molecule loses an adenine or a guanine base. Group of answer choices a. Depurination b. Deamination c. Depyrimination d. Denaturation 3. The difference between a nucleoside and nucleotide is: Group of answer choices a. Nucleotides contains deoxyribose sugar and nucleosides contain ribose sugar b. A nucleoside consists of the sugar with a nitrogenous base, whereas a nucleotide has sugar with a nitrogenous base and phosphate groups attached to the sugar. c. A nucleotide consists of the sugar with a nitrogenous base, whereas a nucleoside has sugar with a nitrogenous base and phosphate groups attached to the sugar. d. Nucleotides are involved in eukaryotic DNA replication, while nucleosides are used in bacterial DNA replication
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive conditions) and expresses the normal phenotype under other conditions (the permissive conditions). One type of conditional mutation is a temperature-sensitive mutation, which expresses the mutant phenotype only at certain temperatures. Strains of E. coli have been isolated that contain temperature-sensitive mutations in genes encoding different components of the replication machinery. In each of these strains, the protein produced by the mutated gene is nonfunctional under the restrictive conditions. You grow these strains under the permissive conditions and then abruptly switch them to the restrictive conditions. After one round of replication under therestrictive conditions, you isolate DNA from each strain and analyze it. What characteristics would you expect to see in the DNA isolated from a strain with a temperature-sensitive mutation in the gene that encodes the following…