Pls helP ASAP 5. Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of eachkind of mutation and explain what will happen to the organism. You may choose which base toalter. Please provide the new amino acid sequence with each mutation in the spaces provided.AUGCCUACGGACUGGCCU 3'(Met/Pro/Thr/Asp/Trp/Pro)Use the following codon chart to help you show the translation of each sequence.The genetic codeSecond LetterCFirstLetterUCAG5'Uphenylalaninephenylalanine serineleucineserineleucineserineleucine prolineleucine prolinehistidinearginine Carginine Aleucineprolineglutamineleucineproline glutamine arginine Gthreonine asparagineisoleucineserineisoleucinestart/Aserine tyrosinetyrosinestopstophistidineisoleucine threonine asparagine serinemethioninevalinevalinevalinevalinea. Frameshift MutationGcysteineUcysteineCstopAtryptophan Garginine Uthreonine lysine argininethreonine lysine argininealanine aspartate glycinealanine aspartate glycinealanine glutamateglycinealanine glutamateglycine[OW YOUR WORKThirdLetter5' AUG / CCU / ACG / GAC / UGG / CCU 3'Met Pro Thr/ Asp / Trp / ProCUCACGUCAG b. Missense Mutation: SHOW YOUR WORK5' AUG/ CCU / ACG / GAC / UGG / CCU 3'Met Pro Thr/ Asp/ Trp / Proc. Silent Mutation: SHOW YOUR WORK5' AUG / CCU / ACG / GAC / UGG / CCU 3'Met/Pro Thr/ Asp/ Trp / Prod. What is the anticodon sequence of the original amino acid?

Introduction The genome consists of DNA/RNA, consisting of either deoxyribonucleotide (In DNA) or…

5. Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of mutation and explain what will happen to the organism. You may choose which base to alter. Please provide the new amino acid sequence with each mutation in the spaces provided. 5' AUGCCUACGGACUGGCCU 3' (Met/Pro/Thr/Asp/Trp/Pro) Use the following codon chart to help you show the translation of each sequence. First Letter U C A G U A phenylalanine serine tyrosine phenylalanine serine tyrosine leucine serine stop serine stop proline histidine leucine proline histidine leucine proline glutamine proline glutamine leucine isoleucine threonine asparagine isoleucine threonine asparagine threonine lysine threonine lysine leucine leucine isoleucine start/ methionine valine valine valine valine The genetic code Second Letter C a. Frameshift Mutation G cysteine cysteine stop tryptophan arginine arginine arginine arginine serine serine arginine arginine alanine aspartate glycine alanine aspartate glycine alanine glutamate glycine alanine glutamate glycine [OW YOUR WORK Met Pro Thr/ Asp/ Trp / Pro 5' AUG / CCU / ACG / GAC / UGG / CCU 3' Third Letter U A C A G

5. Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of mutation and explain what will happen to the organism. You may choose which base to alter. Please provide the new amino acid sequence with each mutation in the spaces provided. 5' AUGCCUACGGACUGGCCU 3' (Met/Pro/Thr/Asp/Trp/Pro) Use the following codon chart to help you show the translation of each sequence. First Letter U C A G U A phenylalanine serine tyrosine phenylalanine serine tyrosine leucine serine stop serine stop proline histidine leucine proline histidine leucine proline glutamine proline glutamine leucine isoleucine threonine asparagine isoleucine threonine asparagine threonine lysine threonine lysine leucine leucine isoleucine start/ methionine valine valine valine valine The genetic code Second Letter C a. Frameshift Mutation G cysteine cysteine stop tryptophan arginine arginine arginine arginine serine serine arginine arginine alanine aspartate glycine alanine aspartate glycine alanine glutamate glycine alanine glutamate glycine [OW YOUR WORK Met Pro Thr/ Asp/ Trp / Pro 5' AUG / CCU / ACG / GAC / UGG / CCU 3' Third Letter U A C A G

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

Figure 14.21 A fr am eshift mutation that results in the insertion of three nucleotides is often less deleterious than a mutation that results in the insertion of one nucleotide. Why?
How many nucleotides are in 12 mRNA codons? 12 24 36 43
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
1. If an amino acid has a codon that ends in a pyrimidine, which of the following is not necessarily true? (Use genetic code to answer the question) A. The other codon is going to have the same two bases as the first and second as the codon described for this amino acid. B. The same sequence as this codon with a purine as the last base is also a codon for this amino acid. C. It has at least two codons. D. The same sequence as this codon with the other pyrimidine as the last base is also a codon for this amino acid. Please answer asap
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…
Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of mutation and explain what will happen to the organism. You may choose which base to alter. Please provide the new amino acid sequence with each mutation. 5’ AUGCCUACGGACUGGCCU 3’ (Met/Pro/Thr/Asp/Trp/Pro) Use the following codon chart to help you show the translation of each sequence. a. Frameshift Mutation : b. Missense Mutation : c. Silent Mutation : d. What is the anticodon sequence of the original amino acid?
1. Below is an amino acid sequence for the following strand of DNA:A G C A A T C C G T C T T G GT C G T T A G G C A G A A C CThat strand has mutated. It is nowA G C A A C C C G T C T T G GT C G T T G G G C A G A A C CUse your knowledge of mutation and protein synthesis to answer the following questions.What mutation has occurred? A. point mutation B. movement of large section of chromosome C. duplication of entire chromosome D. genetic recombination 2. Will this mutation have a real effect? Why or why not?
1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation (b) How many codons are found in the mRNA below?mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7
1. What does it mean when we say the genetic code is redundant? a) A single codon can specify the incorporation of more than one amino acid. b) The genetic code is universal (the same for all organisms). c) The genetic code is different for different organisms. d) More than one codon can specify the incorporation of the same amino acid.