1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation (b) How many codons are found in the mRNA below?mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7

1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation (b) How many codons are found in the mRNA below?mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 4RQ: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains...

See similar textbooks

Related questions

Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…

A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…

Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine…

A: In this question, we are given with a portion of mRNA which has a sequence 5' GACAUGAACAGC 3'. mRNA…

Q: Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the…

A: Deoxyribonucleic acid (DNA) is the genetic material of living organisms. DNA provides the…

Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…

A: Missense Mutation: A missense mutation is a point mutation that results in a codon that codes for a…

Q: How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fully…

A: DNA and RNA differ in only one of the four nitrogenous bases. RNA has uracil instead of thymine. DNA…

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: 120. What is the nature of the molecule coded by each codon(triplet code) of mRNA? A.Peptide bond…

A: Triplet code is a three amino acid each codon (within the code), consists of three, nonoverlapping…

Q: 3. You have assembled a very short contig below, but you don’t know if this is the sense or…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: 1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…

A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…

Q: Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA…

A: Deoxyribonucleic acid (DNA) is capable of adaptation, it is dynamic too. Its nucleotide substances…

Q: Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals 3'-CAA-5' 5'-GUU-3'…

A: Alzheimer's disease causes the brain's atrophy to shrink and the cells of the brain to die. Dementia…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…

A: DNA to mRNA is transcription and mRNA to protein is translation.

Q: 6. How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce? (LS1-1) * Second MRNA…

A: The translation is the process by which the information on the mRNA is transferred into appropriate…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: T The template strand of a gene contains the sequence 3’- TTCAGTCGT-5’. Imagine that the nontemplate…

A: The process of translation involves protein synthesis from messenger RNA (mRNA).Ribosomes translate…

Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU…

A: Ans - a.) AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…

Q: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate…

A: Given: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’.

Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…

A: Introduction: A genetic code is a dictionary that corresponds with the sequence of nucleotides and…

Q: 4. A protein is found with the sequence Met-Thr-Tp-Phe-Lys-Cys-Arg-His-Pro-Gly, A mutant is found…

A: Mutations are change in the nucleotide sequence which results in abnormalities in the protein…

Q: Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA…

A: In the formation of mRNA from DNA, base complementarity rules follow. A pairs to U and T pairs to A.…

Q: i INSERTED make an insertion mutation by inserting a C after the 4th codon. Click show protein. Ø…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: 2. An mRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…

A: Introduction DNA is the hereditary material in humans and almost all other organisms. RNA is used to…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is inherited by the…

Q: 25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: 90. If the mRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3' , then what is the…

A: Ribonucleic Acid ( RNA ) -- Ribonucleic acid is also a type of nucleic acid found in the living…

Q: Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a…

A: The DNA is transcribed into to an RNA by the process of transcription. Following the transcription…

Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…

A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…

Q: 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid…

A: The explanation is given below.

Q: 1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 -…

A: The protein is synthesized by the translation process. It takes place in the cytoplasm.

Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the…

A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.…

Q: Pre-MRNA 5' Cap Poly Codon numbers 105- 146 1-30 31-104 Introns cut out and exons spliced together…

A: The central dogma is a process that includes transcription (production of RNA from DNA) and…

Q: 6. If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: Introduction :- A mutation occurs when the sequence of DNA changes. Mutations can occur as a result…

Q: Given the mRNA sequence below, 5'-UUCCCAAAGUAU-3' Answer the following below: 1. What is the…

A: mRNA synthesis is carried out by the RNA polymerase enzyme. DNA acts as a template for the synthesis…

Q: mutation each as Deletion, Insertion or Substitution AND as either , missense, silent or nonsense…

A: In this question, we have to identify the type of mutation in the given DNA sequence.

Q: Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle…

A: T A C A T C T T G G C G A C G A C T.. A U G U A G A A C C G C T G C T G A METHIONINE (STOP) YES,…

Q: 2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type…

A: Reversion mutation is one that causes such a change in the gene that does not cause change in…

Q: Frameshift Mutations A frameshift mutation involves the insertion or deletion of one or more…

A: Deletion and insertion of a nucleotide from a DNA sequence changes the nucleotide sequence which…

Q: 6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA-…

A: For the expression of a gene, the nucleotide sequences present in the template strand of DNA are…

Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…

A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…

Q: 5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in the tRNA that would bind to…

A: Note: As per the guidelines only one question has to be answered. Please ask the other question…

Q: 12. The following codons and the amino acids they encode is as follows: AUG = Met %3D UUU, UUC = Phe…

A: ANSWER;- a) The sequence of amino acids in the following structure Met-Phe-Leu-Ser-Thr-Pro b)(i) DNA…

Q: Fill in the blanks: The Lys60 (encoded by 5'-AAG-3' codon) of a protein is critical for its binding…

A: The ribonucleic acid or RNA is produced from these DNA by transcription process. Different types of…

Question

1. (a)

"In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."

		missense mutation
		nonsense mutation
		silent mutation
		frameshift mutation

(b)

How many codons are found in the mRNA below?mRNA 5 - AAUAUGCGGAUGCCCGAA -3

		4
		5
		6
		7

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
A scientist identifies a pre-mRNA with the following structure. What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3’ poly-A tail? 220bp 295bp 140bp 435bp
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7 (b) "In this mutation, the UGG codon is replaced with UGA." missense mutation nonsense mutation silent mutation frameshift mutation
1. (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU UUA AUG UAG (b) There is an addition of Adenine in the mRNA sequence specifically at AUG codon. missense mutation nonsense mutation silent mutation frameshift mutation
1. (a)What mutation would result to a change of AUG codon to AGG? missense mutation nonsense mutation silent mutation frameshift mutation (b) Which mutation that would result to a change of amino acid in the polypeptide? missense mutation nonsense mutation silent mutation frameshift mutation
1. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…