Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of mutation and explain what will happen to the organism. You may choose which base to alter. Please provide the new amino acid sequence with each mutation. 5’ AUGCCUACGGACUGGCCU 3’ (Met/Pro/Thr/Asp/Trp/Pro) Use the following codon chart to help you show the translation of each sequence.

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.

A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: Consider the following chart: What type of mutation is this? DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC…

A: By the translation process polypeptide chain is being synthesized from the mRNA sequence by the help…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…

Q: Given below is a DNA sequence as well as its corresponding mRNA and protein amino acid sequences.…

A: Mutation basically refers to the random change in the DNA sequence. These changes can result in a…

Q: Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the…

A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…

Q: Use the bank of terms listed to label all important structures of the diagram of the translation…

A: According to the given translation complex diagram, the structures present are 131 - Polypeptide 132…

Q: Which of the following mutations would be more detrimental to an organism? 1) a mutation that…

A: Mutations are the alterations in the DNA that can happen either due to internal factors like…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Which of the following best describes tRNA? a. Provides the instructions for the amino acid…

A: Translation is the process of formation of amino acids from mRNA sequence.

Q: Use the table below to help you answer the following question. THE CODON TABLE FIRST POSITION SECOND…

A: Ans- Tyrosine was replaced with cysteine.

Q: Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info…

A: Central dogma of molecular biology:   It states that the DNA which contains the genes are…

Q: explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: Define the following terms: a. wobble hypothesis b. aminoacyl-tRNA synthetase c. tRNA d. AUG…

A: Wobble hypothesis was proposed by scientist Crick mainly to explain the observed degeneracy in the…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Transcribe the following DNA sequence into codons.…

A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…

Q: A missense mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon…

A:

Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…

A: During transcription process RNA is formed with the help of complementary base pairing with template…

Q: A single base substitution mutation is likely to have a less harmful effect when the base change…

A: Point mutations are the mutation which cause change in nucleotide base at specific position . It can…

Q: Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code…

A: 4) tryptophan- UGG 5) Leucine- CUU, CUC, CUA, CUG

Q: The first column of the table below shows the beginning of a gene and five different mutations of…

A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…

Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!)       tRNA anticodon (No thymine in…

A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…

Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: When there is an error in the DNA sequence during replication it causes a change in the DNA…

Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…

A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Q: Show the effect of the following types of mutation on the 5th N-base of the given DNA sequence. Use…

A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…

Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: Which of the following is TRUE in translation? A. Amino acyl TRNA containing one amino acid is…

A: The translation is the process by which amino acids chain or polypeptide chain is produced from the…

Q: If the following changes occurred in the gene, identify the type of mutation and how it would affect…

A: Codon is a triple of nucleotide base pair. Any change in the sequence resulting in altered phenotype…

Q: Below is a segment found in the DNA template strand of a gene for a structural protein. This section…

A: The abrupt changes in DNA sequence of nucleotides is called mutation. It may or may not change the…

Q: A gene is a piece of DNA that codes for a protein.  Genes are transcribed into mRNA and are on the…

A: Sometimes mutation disrupts protein synthesis by substitution, deletion, or insertion of one or more…

Q: The codon and anticodon are base-paired together during the process of translation. Which of the…

A: The central dogma of molecular biology involves the transfer of information from DNA to proteins…

Q: Use the following sense DNA sequence 5'- ATGTCCTGGTAA-3' to answer the following questions below.…

A: A) The resulting polypeptide from the mutated DNA sequence is-  5'-ATGTCCTGGTAA-3' Sense DNA…

Q: The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase…

A: DNA and RNA are the biomolecules that make up the part of our genetic material. DNA is the genetic…

Q: You sequence a new tRNA and discover that the anticodon sequence is 5'-IGC-3. What amino acid does…

A: I corresponds to an unusual bas hypoxanthine, which is found in tRNA

Q: Here is a DNA sequence that codes for an extremely short protein. 3' TTACGTGCCGATCGAA 5' template…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: Here is an mRNA sequence (written 5' → 3') A G G G A G G U A A C A G 14 15 16 17 18 19 20 21 24 27…

A: The translation initiation codon is the 5'-AUG-3'. From this codon the first amino acid is…

Q: A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon…

A: Ehlers-Danlos syndrome is a most common genetic connective disorder causing the collagen of body to…

Q: . Consider the genetic code for the amino acid phenylalanine (abbreviations: Phe, F) and single base…

A: A codon is the triplet sequence of DNA or RNA nucleotides which corresponds either to specific amino…

Q: Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond…

A: Polypeptides are chain of amino acids which is bonded by the peptide bonds. It is coded from the…

Q: help

A: Translation is the process for synthesizing the protein from mRNA by the action of ribosomes. It…

Q: The role of transfer RNA (tRNA) is to match a codon (3 bases) in mRNA sequence to:   A. An amino…

A: The process of protein synthesis is also known as translation. It is possible with the help of…

Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: codon

A: The number of codon binding sites in an mRNA-ribosome complex that can be occupied at the same time…

Q: A particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A.  The…

A: The single-stranded RNA is called messenger RNA.  The ribosomes read an mRNA when making proteins.…