5. In Salmonella, the biochemical pathway for the synthesis of histidine involves 10 enzymes, which are encoded by 10 genes. Examine the following nucleotide sequences from two his-mutants and two possible back mutations that can occur. Gene with Mutation hisG Nucleotide sequence in his-Strain GGG Circle the type of back mutation that has occurred in hisG (1 mark): Transcribe each nucleotide sequence (2 marks) substitution Back Mutation GAG deletion insertion

5. In Salmonella, the biochemical pathway for the synthesis of histidine involves 10 enzymes, which are encoded by 10 genes. Examine the following nucleotide sequences from two his-mutants and two possible back mutations that can occur. Gene with Mutation hisG Nucleotide sequence in his-Strain GGG Circle the type of back mutation that has occurred in hisG (1 mark): Transcribe each nucleotide sequence (2 marks) substitution Back Mutation GAG deletion insertion

Name: i need help on this hw question 5. In Salmonella, the biochemical path
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: i need help on this hw question 5. In Salmonella, the biochemical pathway for the synthesis of histidine involves 10 enzymes, which are encodedby 10 genes. Examine the following nucleotide sequences from two his-mutants and two possible backmutations

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 5TYK

See similar textbooks

Similar questions

1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
3. List the amino acid sequence of the protein coded for. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
1. What happen to the mutated sequence in the coding region of MT-ATP6 in Leigh's syndrome. Does it lead to amino acids substitution? Illustrate the process
6. Which of the following statements concerning the BLOSUM62 substitution matrix is correct?a. Ala is aligned with Arg more often than expected by chance.b.Ala is never substituted by Cys.c. Tryptophan is substituted less frequently than any other amino acid.
1. Determine the approximate number of amino acids that would be missing in the telomerase protein of a person who has the autosomal form of dyskeratosis congenita in which a segment of the normal gene has been deleted. b. In some patients with autosomal dyskerptosis congenita , the disorder is caused by one or two nitrogen base substitutions that change the sequence of the DNA the telomerase gene. Describe what would happen to the etlomerase protein if a triplet of the telomerase gene that was normally ACC mutated to become ACT Explain your answer. c. i Identify a field of research, other than days keratosis congenita , that could use knowledge gained about telomerase and telomeres . Explain how this information might be used. c. ii Evaluate how this research could affect either an individual or society. Include one potential advantage and one potential disadvantage in your evaluation.
1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle cell hemoglobin:Normal: GGG CTT CTT TTTSickle: GGG CAT CTT TTTa. Transcribe and translate the normal and sickle cell DNA. b. Identify this as a point or frameshift mutation. Explain. c. If the base sequence read GGG CTT CTT AAA instead, would this result in sickle cell hemoglobin? Explain.
6. How do you know if the halibut you purchased at thesupermarket is really halibut? To identify the sourceof a biological sample, scientists PCR amplify andthen sequence a region of DNA known to vary between species. For animals, this DNA region is a648–base pair portion of the mitochondrial cytochrome oxidase I gene. The sequence of this mtDNAregion acts as a so-called DNA barcode because adatabase exists that contains the sequences of thismtDNA region that are unique for hundreds ofthousands of animal species.a. Why do you think that a region of mitochondrialDNA is used for barcoding animals, as opposed toa region of nuclear genomic DNA?b. A single pair of PCR primers can be used tobarcode any species of fish. Explain how this ispossible.c. List criteria that scientists would have consideredwhen determining which mitochondrial DNAsequence to use for barcoding animals.
4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?
4. Some transposases use extensive DNA replication to leave one copy of the element behind in a process called ____________________.A. persistent transpositionB. chronic transpositionC. exchange transpositionD. replicative transpositionE. none of the above 5. Which of the following is not an example of a transposable element found in bacteria?A. Tn5B. Tn10C. IS1D. IS903E. Xis 6. Besides a transposase, many common composite transposons in bacteria encode genes for:A. Toxin productionB. Antibiotic resistanceC. DNA repairD. Homologous recombinationE. None of the above
1. What are the new DNA sequences and the corresponding new amino acid sequencesof these two mutations? (2 answers: 1 for T-deletion; the other for G-insertion.
1. Which of the following statements about the flow of genetic information is correct?A. Translation occurs prior to transcription during protein synthesis.B. During translation, the DNA template is converted to amino acids by the ribosomes.C. During transcription, the DNA template is converted to an RNA molecule by the enzyme RNA polymerase.D. Eukaryotic mRNA needs to be transported to the cytoplasm before the protein products are synthesized. 2. What is the main difference in the cell wall composition between eukaryotes and prokaryotes?A. Eukaryotic cell wall is mainly composed on sugar molecules while prokaryotic cell wall has both sugars and amino acids.B. Prokaryotic cell wall is mainly composed on sugar and lipid molecules while eukaryotic cell wall has both sugars and amino acidsC. Prokaryotic cell wall is mainly composed on sugar molecules while eukaryotic cell wall has both sugars and amino acids.D. Eukaryotic cell wall is mainly composed on sugar and lipid molecules while…