513 5' 3' Bacterial RNA polymerase cannot associate with DNA on its own; it requires an additional factor to help it recognize specific regulatory sequences. Locate this factor in the palette and bring it to the RNA polymerase. p-Helicase -35 Promoter Sequence RNA Polymerase -10 Promoter RNA Hairpin Sequence 070 3 355 5

513 5' 3' Bacterial RNA polymerase cannot associate with DNA on its own; it requires an additional factor to help it recognize specific regulatory sequences. Locate this factor in the palette and bring it to the RNA polymerase. p-Helicase -35 Promoter Sequence RNA Polymerase -10 Promoter RNA Hairpin Sequence 070 3 355 5

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′3′ … AACTGT … ATATTA … 5′a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand?
Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding sequences. Label template strand: 5’-ACTGTGACCTTGACTGTCGATACGATG-3’ 3’-TGACACTGGAACTGACACGTATGCTAC-5’
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism?
Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
91The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yesorno 92Core polymerase (α2ββ’) use intact double-stranded DNA as a template. Yesorno 93Protein synthesis machinery reads the mRNA nucleotide sequence in groups of three bases or ______________. A.operatorsb.codonsc.open reading framesD.operons
The following sequence is a double stranded DNA. 5'ATTTGACAATGCGTTAGGCATGACTATGTATAATGCATGCCACATACT... 3' 3'TAAACTGTTACGCAATCCGTACTGATACATATTACGTACGGTGTATGA…5' -35 -10 +1 Where does RNA polymerase initially binds?
Frameshift Insertion Mutation – Can be one or more nucleotides. 5’ ATG GGG AAA GAT TAT TAG 3’ (non-template strand) 3’ TAC CCC TTT CTA ATA ATC 5’ (template strand) What is the resulting mRNA sequence now? What is the resulting amino acid sequence now?
Primer 1 primes synthesis of the 5' to 3' strand (i.e. sense strand) of an oat cDNA/gene and encodes for first few amino acids appearing at the N-terminal end of the corresponding polypeptide. Primer 156 primes synthesis of the 3' to 5' strand (i.e. antisense strand) of an oat cDNA/gene and encodes for the last few amino acids appearing at the C-terminal end of the polypeptide. The polypeptide encoded by this gene is 156 amino acids in length. QUESTION:-Assume that a PCR using the combination of Primer 1 and Primer 156 plus oat genomic DNA resulted in the amplification of a DNA fragment of the 160bp larger than PCRs in (1) above. With respect to the structure to this relevant gene, what does this result indicate? Explain how you reached this conclusion
The following represents a transcription unit in a hypothetical DNA molecule in E.coli. (Transcription can use either strand, but by convention we always put 5’à 3’ on the top.) 5’…..TTGACANNNNTATAAT…3’ 3’…..AACTGTNNNNATATTA…5’ If this molecule is transcribed from left to right, then the ____ strand will be the template strand and the ___ strand will be the non-template strand. top, bottom bottom, top