The following represents a transcription unit in a hypothetical DNA molecule in E.coli. (Transcription can use either strand, but by convention we always put 5’à 3’ on the top.)
Q: Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein…
A: Transcription is a process from central dogma where a DNA strand is used as a template to synthesize…
Q: After being irradiated, the gene coding for the E site is mutated, causing the E site to have a…
A: The process of the formation of RNA from DNA is called transcription. The process of the formation…
Q: Which of the following set(s) of primers a-d could you use to amplify the following target DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…
A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…
Q: What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Nucleic acids are the type of biomolecules that forms the genetic system of almost all living…
Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…
A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…
Q: The coding sequence for gene F is read from left to right on the accompanying figure. The coding…
A: DNA is the polymer of nucleotides.
Q: Suppose you want to study the transcription in vitro of one particular gene in a DNA molecule that…
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: The process in which a specific sequence of DNA is copied to form a newly synthesized strand of…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: If you add all of the components necessary for transcription to a test tube, which nucleic acids…
A: Nucleic acids, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), carry genetic…
Q: Euchromatin is said to be transcriptionally-active while Heterochromatin is said to be…
A: Euchromatin exists in decondensed form and is found in the distal arms of the chromosome. It is…
Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…
A:
Q: During eukaryote transcription initiation, when TFIIE, TFIIA, TFIIB, TFIIF, and RNA pol II all join…
A: Transcription factor is a protein that binds to a specific region in DNA that controls the…
Q: A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of…
A: Template DNA sequence - 5’-CGATTACTG-3’ After transcription the sequence - GCUAAUGAC Explanation -…
Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…
A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…
Q: What do you mean by cross-exon recognition complex ?
A: CROSS - EXON RECOGNITION COMPLEX : The sequence of DNA present in mature messenger RNA some of which…
Q: Give two reasons why both the strands are not copied during transcription?
A: Processes of synthesizing RNA from DNA with the help of an enzyme RNA polymerase is termed as…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: Genetics is the study of how traits are passed from one generation to another. This includes but is…
Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…
A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…
Q: The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was…
A: The synthesis of RNA (ribonucleic acid) from DNA (deoxyribonucleic acid) by the enzyme RNApolymerase…
Q: What would be the likely effect of a mutation that prevents σ from dissociating from the RNA…
A: After the initiation of the transcription, the RNA strand would elongate by the action of RNA…
Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…
A: Proteins are defined as polymers of amino acids. As there are 22 standard alpha-amino acids by which…
Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…
A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…
Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…
A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…
Q: Use the (non-template) DNA strand below to determine which is the promoter/sigma binding region:…
A: Introduction: A promoter is a DNA sequence to which proteins bind to start transcription of a single…
Q: Sometimes errors occur during transcription or translation. each amino acid is coded for by several…
A: This suggests that the genetic code is degenerate which means that each codon is specific for only…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…
A: DNA stands fo deoxyribonucleic acid. It is the genetic material.
Q: What are the specific steps of eukaryotic transcription? Be sure in your discussion that you include…
A: Transcription is the process which consist of several steps of DNA based gene expression.Here a…
Q: Several examples of antisense RNA regulating translation in bacterial cells have been discovered.…
A: Introduction Gene silencing is the technique by which the expression of any gene can be inhibited…
Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…
A: Introduction Termination of transcription: It involves the termination of RNA chain synthesis by…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…
Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……
A: Bacterial transcription is the process in which a segment of bacterial DNA is copied into a newly…
Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……
A: Bacterial transcription is the process in which a segment of bacterial DNA is copied into a newly…
Q: can cells tolerate errors made in transcription in comparison to errors made during DNA replication?
A: RNA polymerase lacks proofreading activity, so the probability of error is more than that of DNA…
Q: Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than…
A: Genetic code is defined as the set of nucleotides which determine the sequence of DNA of a given…
Q: You isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the…
A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a…
Q: n the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding…
A: There are two types of the strand, i.e., the coding strand and the template strand present in the…
Q: Computer programmers, working with molecular geneticists, have developed programs that can identify…
A: Transcription is the process by which the information in a strand of deoxyribonucleic acid (DNA) is…
Q: Heparin is a polyanionic polysaccharide that blocks initiation by RNA polymerase by virtue of its…
A: RNA polymerase is a multi-subunit enzyme that catalyses the process of transcription where an RNA…
Q: You are studying the rate of transcription of a particular eukaryotic gene. When the DNA located…
A: Transcription is copy of genetic information from DNA to RNA. Eukaryotic transcription is more…
Q: What amino acid is coded by the original sequence (GTA) if the sequence refers to the template…
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…
Q: 8. ----ATTATA--- ----TAATAT--- Fill in the polarity of the strands? Which strand is the coding…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The interphase nucleus is a highly structured organelle with chromosome territories, interchromatin…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: f you made a change in the promoter sequence in the DNA that inactivates the promoter, what would…
A: Promoter is present upstream the DNA which contains the binding sites for the DNA polymerase to bind…
The following represents a transcription unit in a hypothetical DNA molecule in E.coli. (Transcription can use either strand, but by convention we always put 5’à 3’ on the top.)
5’…..TTGACANNNNTATAAT…3’
3’…..AACTGTNNNNATATTA…5’
If this molecule is transcribed from left to right, then the ____ strand will be the template strand and the ___ strand will be the non-template strand.
- top, bottom
- bottom, top
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
- The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′3′ … AACTGT … ATATTA … 5′a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand?
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?