6) Consider the maternal effect gene that controls snail coiling where D= dextral, dominant, d=sinistral, recessive. Indicate the genotype(s) and phenotype(s) of offspring from the following crosses - females are written on the left, males on the right for each cross. Progeny Genotype(s) (Include ratio) Progeny Phenotype(s) (Include ratio) 1. Dd x Dd 2. dd x Dd 3. Dd x DD 4. Dd x dd
Q: How does the hormone glucagon affect glycogen degradation, glycolysis, and TCA cycle? Explain the…
A: Glucagon is the antagonist to insulin and increase glucose concentration in the blood.
Q: 2. In fruit flies: At the b locus, + = normal color b = black body At the v locus, + = normal wing v…
A: An individual expressing a dominant trait could have two copies of the dominant allele (homozygous…
Q: You would like to clone a gene from a thermophilic bacterium isolated from a hot spring. The…
A: Designed protocol for cloning and expression 1. DNA extraction of the thermophilic bacterium using…
Q: 10 b. The half-life of polonium-218 is 3.0 min. If you start with 20.0 g, how long will it be before…
A: According to the question The initial concentration is 20g No = 20g The final concentration…
Q: Transcription involves synthesis of [Select] using [Select] beings at [Select] [Select] of RNA is…
A: Introduction :- A DNA fragment is copied into RNA during transcription. Messenger RNA is created…
Q: convert 120000 nanogram/minute to mg/day
A: Please follow step 2 for detailed explanation.
Q: Suppose you had isolated a new transcription factor and wanted to know which genes this protein…
A: Microarray : is a laboratory technique used to simultaneously measure the expression of thousands of…
Q: Oldfield mice that live on beaches of the gulf and Atlantic coast of Florida tend to white, wherease…
A: The oldfield mouse or the beach mouse is a nocturnal species of rodent in the family Cricetidae.…
Q: What would happen to the ecosystem services provided by a coral reef if it were to sustain permanent…
A: Numerous crucial services are offered by coral reefs to both the environment and people. They…
Q: .4 Indicate whether the following statements are true or false. For each FALSE answer please…
A: Introduction : In order to absorb nutrients, complex food particles must be broken down into…
Q: An increase in epinephrine results in: a. An increase activity of insulin. b. An…
A: In emergency or stress condition (Like injury, pain, fear, accident, etc.), impulses from…
Q: 2. If a potted plant is covered with a glass jar, water vapors appear on the wall of glass jar.…
A: Transpiration is the process through which water is evaporated from plant components with stomata,…
Q: List five important characteristics of epithelial tissue
A: We know that Epithelial tissues comprise thin tissues that cover the entire body's exterior…
Q: roblem 1 a) State the different requirements for a disinfectants b) State the advantages and…
A: Disinfection is process of the application of a chemical agent to destroy or inhibit the growth of…
Q: Explain and give examples of the major functions of the liver.
A: Introduction The liver is the body's second-largest organ. It contains four lobes and can…
Q: Match each statement with the best possible single answer from the list below. Terms may be used in…
A: Addition of TTGGGG repeats Correct match for this statement are - Telomerase. Explanation…
Q: The schematic on the right is for which molecular biology method? What information…
A: Please follow steps 2 & 3 for detailed explanation.
Q: Phylogenetic hypothesis 1 requires. changes, whereas hypothesis 2 requires Hypothesis I Hypothesis…
A: Phylogeny represents evolutionary relationship between taxons. It is used to find the evolutionary…
Q: Briefly discuss the following topics and include appropriate examples for each: 1.1. Information…
A: All of the branches of the natural sciences that focus on different facets of life's processes are…
Q: 2. Circle all inheritance patterns that you cannot rule out to explain this pedigree: a. autosomal…
A: Pedigree:- When the inheritance off particular character sticks or disease or any other health…
Q: 15. 1 1 2 3 What part of the nucleotide represents a nitrogen base?
A: A nucleotide is the fundamental building block of nucleic acid and we know that nucleic acid which…
Q: What are the THREE (3) important regions in all plasmids? Explain their functions.
A: Introduction :- A plasmid is a discrete piece of extrachromosomal DNA that is physically distinct…
Q: Besides real time PCR, Shania will also be using other variations of PCR; Multiplex PCR, Reverse…
A: Multiplex PCR used in temperature-mediated DNA polymerase in a thermal cycler. Multiplex PCR is…
Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…
A: Many people agree that one of the 20th century's most significant contributions to molecular biology…
Q: Search for genes involved in envelope components by searching the gene annotations and report how…
A: …
Q: Put the following DNA replication events in the correct order: Primase synthesizes an RNA primer. 2
A: DNA replication is the process by which a DNA duplicates itself and forms new strands during the S…
Q: a. Briefly describe the pharmacokinetics of inhaled nicotine. Would you expect pharmacokinetics of…
A: Nicotine is a naturally produced alkaloid in the nightshade family of the plants . It is widely used…
Q: Which statement below best describes what these data might have demonstrated to Kornberg about the…
A:
Q: Why do you think most bacteria grown in labs are mesophiles with a pH optimum for growth near 7.0,…
A: Mesophiles are a group of bacteria that grow well in the temperature of 20 degree Celcius to 45…
Q: What makes transparent softening lotion different from suspension softening lotion? Is it because of…
A: Cosmetics can be differentiated into various sub-categories based on various features, such as:…
Q: In gene cloning, a vector is required to transform the gene of interest into host cell. State the…
A: In gene cloning, a vector is required to transform the gene of interest into the host cell. The…
Q: Having been carried from adipose tissue in the bloodstream, fatty acids are taken into muscle by…
A: Answer : such as albumin and triacylglycerols. Reason : Fatty acids are either complexed with…
Q: glucagon is synthesized and secreted from the α-cells of the pancreas. Please describe how glucagon…
A: After the meals or in between the meals blood glucose levels tends to fall because of the continued…
Q: 2. Imprinted genes: A) Provide an example of epigenetic inheritance. B) Often are near…
A: Epigenetic regulation of the genome is an absolute critical facet of organism's development. Gene…
Q: In Semi conservative replication: A. After one round of replication of a single molecule of DNA, one…
A: Answer b) After one round of replication of a single molecule of DNA, two resulting DNA molecules…
Q: Fill in the blanks. Blanks with the same letter are the same molecule. Molecules to use:…
A: Water is necessary for transpiration, photosynthesis, and respiration in order for plants to grow…
Q: Plant Histology Study Card 1 Bienn ©2014 Carolina Biological Supply Company Plant Histology Study…
A: Plant is a photosynthetic, eukaryotic structure, multicellular that belongs to plant Kingdom. Plant…
Q: Using the data provided 6. Which carbohydrate (fuel) did yeast use fastest (i.e. most gas produced?…
A: Yeasts are the eukaryotic, single-celled microorganisms classified as members of the kingdom fungus.…
Q: During which phase of teh process of aerobic cellular respiration is carbon dioxide produced?
A: Carbon dioxide is the gas which plays an imp. role in vital plant and animal process, such as the…
Q: Besides using A. tumefaciencs in the generation of transgenic plants, elaborate on the THREE (3)…
A: Agrobacterium tumefaciens, a gram negative bacteria that is used to perform horizontal gene transfer…
Q: 7. Match the bases: Adenine, thymine, cytosine and guanine as found in DNA. 8. Which sugar is found…
A: Biomolecules are the most important organic compounds that are engaged in the upkeep and metabolic…
Q: The genomes of two E. coli strains are compared in Figure 14-19. Would you expect any third strain…
A: The availability of this genome sequence will aid in the identification of genes responsible for…
Q: mutations/defects
A:
Q: other diseases like Kwashiorkor Syndrome
A: Kwashiorkor: It is a condition which results from the inadequate protein intake. Initial symptoms…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
Q: A shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two…
A: The episomal vectors are the plasmid constructions that replicate in both eukaryotic and prokaryotic…
Q: Which of the following statements are true about the rate of mutation in tumor cells (select all…
A: Chromosome rearrangements, which occur at high rates due to aneuploidy, an aberrant chromosome…
Q: NoCases 8000- 6000- 4000- 2000- 0- Apr 2020 Jul 2020 Oct 2020 DateRepConf Jan 2021 . Apr 202
A: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19). The majority…
Q: 19% dominant phenotype 0.19 = p2 + 2pq What is the dominant allele frequency?
A: The individual has two alleles for a gene. These are dominant and recessive alleles.
Q: *REQUIRED 23. What are the inputs of the Light Dependent Reaction represented by
A:
Need help, please.
For the progeny
Step by step
Solved in 3 steps with 1 images
- In cats, the genotype AA produces tabby fur color; Aa is also a tabby, and aa is black. Another gene at a different locus is epistatic to the gene for fur color. When present in its dominant W form (WW or Ww), this gene blocks the formation of fur color and all the offspring are white; ww individuals develop normal fur color. What fur colors, and in what proportions, would you expect from the cross AaWw Aa Ww?A true-breeding rabbit with agouti (mottled, grayish brown) fur crossed with a true-breeding rabbit with chinchilla (silver) fur produces all agouti offspring. A true-breeding chinchilla rabbit crossed with a true-breeding Himalayan rabbit (white fur with pigmented nose, ears, tail, and legs) produces all chinchilla offspring. A true-breeding Himalayan rabbit crossed with a true-breeding albino rabbit produces all Himalayan offspring. Explain the inheritance of the fur colors.1) By convention, the recessive trait will determine the abbreviation used to track crosses if it is a mutant condition, since it stands out in contrast to the rest of the population. For example, if pea pods are typically green in color, a mutant condition might result in yellow pea pods; therefore, the lowercase letter ‘y’ would be used to depict the mutant state, yellow, while uppercase ‘Y’ would depict the wildtype (wt) condition, green. Remember that the mutant condition is not necessarily always recessive. 1 A) . If green is dominant wt (Y) and yellow is a recessive mutant condition (y), depict a Yy father mated with a YY mother in the Punnett. 1B) Considering the dominant allele, what colors are the parents in the cross above? Yy = _____________________ YY = _____________________ 1C) What colors are the offspring in the cross above? 1D) What is the phenotypic ratio of the offspring? 1E) What is the genotypic ratio of the offspring? (Remember, the genotypic ratio is based…
- 7. In guinea pigs, black hair colour (B) is dominant and brown hair colour (b) is recessive. Long hair (L) is dominant and short hair (l) is recessive. Answer the following questions: (a) Diagram the cross: BbLl x BbLL (b) What are the phenotypes of the parent generation? (c) What are the genotypes and phenotypes of the F1 generation?4. An albino corn snake is crossed with a normal-coloredcorn snake. The offspring are all normal-colored.When these first-generation progeny snakes arecrossed among themselves, they produce 32 normalcolored snakes and 10 albino snakes.a. How do you know that only a single gene is responsible for the color differences between these snakes? b. Which of these phenotypes is controlled by thedominant allele?c. A normal-colored female snake is involved in atestcross. This cross produces 10 normal-coloredand 11 albino offspring. What are the genotypes ofthe parents and the offspring?2. a. A Drosophila male from a true-breeding stockwith scabrous eyes was mated with a female from atrue-breeding stock with javelin bristles. Both scabrous eyes and javelin bristles are autosomal recessive mutant traits. The F1 progeny all had normaleyes and bristles. F1 females from this cross weremated with males with both scabrous eyes andjavelin bristles. Write all the possible phenotypicclasses of the progeny that could be produced from the cross of the F1 females with the scabrous, javelin males, and indicate for each class whether it is arecombinant or parental type.b. The cross in part (a) yielded the following progeny:77 scabrous eyes and normal bristles; 76 wild type(normal eyes and bristles); 74 normal eyes andjavelin bristles; and 73 scabrous eyes and javelinbristles. Are the genes governing these traits likelyto be linked, or do they instead assort independently? Why?c. Suppose you mated the F1 females from the crossin part (a) to wild-type males. Why would thiscross fail…
- 8. In guinea pigs, the allele for black fur (B) is dominant over the allele for white fur (b). Similarly, the allele for straight hair (H) is dominant over the allele for having rough hair (h). Pure breeding rough haired guinea pigs with black fur were crossed with pure breeding straight haired guinea pigs with white fur. a. State the genotype and the phenotype of the F1 individuals produced as a result of this cross.b. Two F1 offspring were mated together. Calculate the expected ratio of phenotypes in the F2 generation.c. Show the completed Punnett square below.1. Fur color of rats is determined by the pathway below. The mating between brown rats of identical genotypesproduced the following offspring: 14 cream-colored, 47 Brown, and 19 albino.Gene B Gene DAlbino Cream Browna. What type of inheritance is this?b. What is the genotype of the two parents?c. Complete the cross described above. Identify which genotypes are brown, cream, and albino. Includethe expected phenotypic ratio (brown:cream:albino)1. In a cross between a black and a white guinea pig, all members of the F1 generation are black. The F2 generation is made up of approximately 3/4 black and 1/4 white guinea pigs. (a) Diagram this cross, showing the genotypes and phenotypes. (b) What will the offspring be like if two F2 white guinea pigs are mated?
- 7. In rabbits, a locus involved in the control of coat colour may be occupied by any of fouralleles: Full colour (C), Sepia (ck), Cream (cd), or Albino (ca). A geneticist counted the numberof Full colour (C), Sepia (ck), Cream (cd) and Albino coat offspring resulting after crossesbetween Sepia (ck) and Cream (cd) coloured coated parents. The results were as follows.• Full colour (C): 152• Sepia (ck): 53• Cream (cd): 39• Albino (ca): 6Mendelian inheritance of this trait predicts that the ratio of Full colour (C) to Sepia (ck) to Cream(cd) to Albino (ca) should be 9:3:3:1. Do the experimental results support this mode ofinheritance?1. Dihybrid crosses: In dogs, black coat color(B) is dominant to yellow coat fur (b), and straight fur (F) is dominant to curly fur (f). The coat color gene and the fur texture gene are on different chromosomes, so they assort independently, and are not sex linkied. Determine the ratio of having a yellow dog with straight hair if the parents are: BbFF x Bbff a. What are the phenotype of the parents? b. Complete a punnet square. List all the genotypes of the predicted offsprin of this mating c. Based on your Punnet sqaure, list all the genotypes for offspring that would yield a dog with yellow straigh hair d. Based on the punnet square, what is the predicted phenotypic ratio for those parents having a dog with black curly hair.4. Marfan syndrome is a genetic trait caused by in a dominant allele. The trait causes a weakening of the aorta that can be fatal. A teenager whose mother has the syndrome (but whose maternal grandfather was not affected), and whose father was unaffected, is concerend that she may have the trait. a. What is the phenotype of each of her parents? Genotype? b. What is the chance that the teenager has Marfan syndrome?