6. Jo is completing their undergraduate research project and has run out of Tagpolymerase. They remember that, in humans, DNA is synthesised by DNApolymerase III and so adds some of that to the reaction. When the PCR products areanalysed, the results show that the amplification failed. Why did it fail?

PCR or polymerase chain reaction is the method used for amplifying specific DNA regions. This method…

6. Jo is completing their undergraduate research project and has run out of Tag polymerase. polymerase III and so adds some of that to the reaction. When the PCR products are analysed, the results show that the amplification failed. Why did it fail? They remember that, in humans, DNA is synthesised by DNA

6. Jo is completing their undergraduate research project and has run out of Tag polymerase. polymerase III and so adds some of that to the reaction. When the PCR products are analysed, the results show that the amplification failed. Why did it fail? They remember that, in humans, DNA is synthesised by DNA

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 12TYK: Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to...

See similar textbooks

Similar questions

After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.
1. If you forgot to add nucleotides to your PCR master mix, which control reaction tube would have results that are different than they would be if you had prepared them correctly? 7. If you found that there was DNA amplification in your negative control tube, what could be an explanation for that result?
1. What is the function of the DNA polymerase enzyme in the PCR? 2. What natural process is PCR based on?
1. If you will use apple or strawberries instead of banana do you think the result would be the same in the extraction of DNA from a banana? Why or why not?
1.Briefly explain the rationales of adding chemicals that can affect DNA stability in a polymerase chain reaction (PCR). 2.Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.
1.) What are the different temperatures used in PCR (polymerase chain reaction)? What happens at each temperature? 2.) What ingredients are used in PCR? What role does each ingredient have in replicating DNA? 3.) Why is the contamination of foreign DNA a particularly important problem when you do PCR?
2. What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b. It displaced a lot of proteins to free the DNA. c. It disrupts the phospholipid bilayer. d. It precipitates the DNA.
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
4. How is a randomized DNA library created? MARK ALL THAT APPLY. the use of Mn2+ rather than Mg2+ by DNA Polymerase PCR with dideoxynucleotides Mutagenic PCR Lots of books Add more dNTPs than normal to a PCR reaction
1. The extraction of DNA is a common procedure in biotechnology research laboratories. Research the methods of extracting DNA in biotechnology facilities. Describe how the extraction methods used in this lesson compare to those of research laboratories.
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.