3. A long DNA will be divided into small fragments, and one of them will be attached to the bead and amplified in lon Torrent sequencing. The beads with different kinds of fragments will be loaded into different wells. The following graphs show the first forty (40) signals from two different wells. The value of one (1) in the y-axis of the graph corresponds to incorporation of one (1) nucleotide to every DNA strand on a bead. (a) You can observe that in every single step the signals are not the multiples of an integer. Explain why such signals are produced and how we can interpret the signals. (b) Using the first forty (40) signals shown below, please figure out the DNA sequence of the fragment attached to the bead in each well. (c) Based on the sequences of the fragments, can we guess the partial sequence of the original DNA sequence (before fragmentation)? If so, what could it be? (d) In the well #1, when the non-zero signals will show up after the 40 steps? Answer this by the step number, and explain why. Signals from well #1 3 TACGTACGTACGTACGTACGTACGTACGT ACGTACGTAC G Signals from well #2 3 السليسياسيليلل TACGTACGTACGTACGTACGTACGTACGTACGTACGTACG Bases Bases 2.

3. A long DNA will be divided into small fragments, and one of them will be attached to the bead and amplified in lon Torrent sequencing. The beads with different kinds of fragments will be loaded into different wells. The following graphs show the first forty (40) signals from two different wells. The value of one (1) in the y-axis of the graph corresponds to incorporation of one (1) nucleotide to every DNA strand on a bead. (a) You can observe that in every single step the signals are not the multiples of an integer. Explain why such signals are produced and how we can interpret the signals. (b) Using the first forty (40) signals shown below, please figure out the DNA sequence of the fragment attached to the bead in each well. (c) Based on the sequences of the fragments, can we guess the partial sequence of the original DNA sequence (before fragmentation)? If so, what could it be? (d) In the well #1, when the non-zero signals will show up after the 40 steps? Answer this by the step number, and explain why. Signals from well #1 3 TACGTACGTACGTACGTACGTACGTACGT ACGTACGTAC G Signals from well #2 3 السليسياسيليلل TACGTACGTACGTACGTACGTACGTACGTACGTACGTACG Bases Bases 2.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Similar questions

The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
Which of the following statements about DNA is false? a. Phosphate is linked to the 5 and 3 carbons of adjacentdeoxyribose molecules. b. DNA is bidirectional in its synthesis. c. Each side of the helix is antiparallel to the other. d. The binding of adenine to thymine is through three hydrogenbonds. e. Avery identified DNA as the transforming factor in crossesbetween smooth and rough bacteria.
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.
4. In bacterial cells, nucleotide excision repair involves which of the following proteins?A. DNA glycosylaseB. AP endonucleaseC. photolyaseD. AlkBE. UvrABC proteins 5. If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is:A. constructiveB. semiconservativeC. conservativeD. consecutiveE. cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair?A. DNA polymerase IB. DNA polymerase IIC. DNA polymerase IVD. DNA polymerase VE. none of the above
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. Genosensors are biosensors based on the principle of complementarity and hybridization of DNA strands. Which factor may be the least important in the regulation of the process? length of the DNA sequence primer length concentration of the DNA composition of the DNA sequence salt concentration temperature 2. Which of the following produces a T1-weighted image? TR = T1, TE << T2 TR >> T1, TE = T2 TR = T1, TE = 2 TR >> T1, TE << T2
1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase Reverse transcriptase RNA Polymerase Endonuclease 6. Sanger DNA sequencing relies on a method known as chain termination. Which molecule is used to terminate DNA chains to create molecules of all possible lengths covering the fragment to be sequenced? Deoxyribonucleotides Deoxyadenosine Deoxyguanosine Dideoxynucleotides
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'